Miyakogusa Predicted Gene
- Lj3g3v1011010.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v1011010.1 tr|G7JFG9|G7JFG9_MEDTR F-box/LRR-repeat protein
OS=Medicago truncatula GN=MTR_4g130200 PE=4
SV=1,61.96,3e-19,FBD,FBD,CUFF.41991.1
(282 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BP036975 379 e-105
>gnl|LJGI|BP036975
Length = 528
Score = 379 bits (191), Expect = e-105
Identities = 257/279 (92%)
Strand = Plus / Minus
Query: 1 atggacattctccaaaagacacctaaattggaagttcttcatattccaatgggatttgac 60
||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 443 atggaaattctccaaaagacacctaaattggaagttcttcatattcctatgggatttgac 384
Query: 61 ccacagatctgcatggatggtgaagacgggatattgaactcagttccttgttgtttcaaa 120
|||||||||||| |||||||||| ||| ||| ||||||||||| |||||||||||||||
Sbjct: 383 ccacagatctgcttggatggtgaggactggaggttgaactcagtaccttgttgtttcaaa 324
Query: 121 tatagtctcaaatcattttctatttcatattttgatgggggtgaagctgaaatccagttg 180
||||||||||||| ||| ||||||||| ||||||||||| |||||||||| || ||||||
Sbjct: 323 tatagtctcaaattattctctatttcaaattttgatgggagtgaagctgacattcagttg 264
Query: 181 ctgaagtttttgttagaaaatgctacagttttagaggagatccggatattctgttcgaaa 240
|||| ||||||||||||||| || | |||||||| ||||||||||||||||||||| |||
Sbjct: 263 ctgaggtttttgttagaaaacgccagagttttaggggagatccggatattctgttctaaa 204
Query: 241 actttatcttctaatttgaagaagcaggctgagatcagc 279
||||||||| || ||||||||||||||||||||||||||
Sbjct: 203 actttatctgctgatttgaagaagcaggctgagatcagc 165