Miyakogusa Predicted Gene

Lj3g3v0962150.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v0962150.1 tr|I3RSY1|I3RSY1_LOTJA R2R3MYB transcription
factor (Fragment) OS=Lotus japonicus GN=MYB10 PE=2
SV=1,100,0,HTH_MYB,Myb domain; Homeodomain-like,Homeodomain-like;
seg,NULL; MYB DNA BINDING / TRANSCRIPTION FAC,CUFF.41845.1
         (1098 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AV778116                                                     646   0.0  
gnl|LJGI|AV421932 homologue to UniRef100_Q43524 Cluster: Transcr...    68   1e-10
gnl|LJGI|BW624444 homologue to UniRef100_A7PCT7 Cluster: Chromos...    62   8e-09
gnl|LJGI|TC75066 similar to UniRef100_A7Q1U0 Cluster: Chromosome...    58   1e-07
gnl|LJGI|TC62535 similar to UniRef100_A7Q8B3 Cluster: Chromosome...    58   1e-07
gnl|LJGI|TC69494 UniRef100_Q84PP4 Cluster: Transcription factor ...    54   2e-06
gnl|LJGI|BW599880 similar to UniRef100_Q9S7E3 Cluster: GmMYB29A1...    52   7e-06
gnl|LJGI|TC81472 homologue to UniRef100_Q2LME4 Cluster: MYB20; n...    52   7e-06
gnl|LJGI|TC62351 similar to UniRef100_Q0PJJ9 Cluster: MYB transc...    52   7e-06
gnl|LJGI|TC57493 similar to UniRef100_A2Q4I4 Cluster: Homeodomai...    52   7e-06

>gnl|LJGI|AV778116 
          Length = 543

 Score =  646 bits (326), Expect = 0.0
 Identities = 338/342 (98%)
 Strand = Plus / Minus

                                                                        
Query: 757  gttgaaattccatgggaatcagattatgatatttggagtttgttagatagcattgaatct 816
            ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 543  gttgaaattccatgggaatcagattatgatatttggattttgttagatagcattgaatct 484

                                                                        
Query: 817  ttcccaccaaatgaagtaccattgggggccagtcagaatcatgatcttggagtagagagt 876
            |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 483  ttcccacccaatgaagtaccattgggggccagtcagaatcatgatcttggagtagagagt 424

                                                                        
Query: 877  gttcaagttactgaagccatgaagtggtcccatgaatttgaaggcaaggctggagtagtt 936
            |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 423  gttcaagttactgaagccatgaagtggtcccatgaatttgaaggcaaggcgggagtagtt 364

                                                                        
Query: 937  ggtgaaacaaatgagtcaaacaaggatcagttcctaccaaagaattatgcagttgagcca 996
            |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 363  ggtgaaacaaatgagtcaaacaaggatcagttcctacccaagaattatgcagttgagcca 304

                                                                        
Query: 997  caaatagaccctcctcagacatttcacttcaatgacatgacaagcccagcagaatctgaa 1056
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 303  caaatagaccctcctcagacatttcacttcaatgacatgacaagcccagcagaatctgaa 244

                                                      
Query: 1057 ttagactttgattttattcaattatggccctcttccccttaa 1098
            ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 243  ttagactttgattttattcaattatggccctcttccccttaa 202


>gnl|LJGI|AV421932 homologue to UniRef100_Q43524 Cluster: Transcription factor; n=1;
           Solanum lycopersicum|Rep: Transcription factor - Solanum
           lycopersicum (Tomato) (Lycopersicon esculentum), partial
           (29%)
          Length = 369

 Score = 67.9 bits (34), Expect = 1e-10
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                     
Query: 134 aagctgggcttcagagatgtgggaaaagttgtcgtttgagatggatcaattatctgag 191
           ||||||||||||| || |||||||| |||||||| ||||||||||| |||||| ||||
Sbjct: 205 aagctgggcttcaaaggtgtgggaagagttgtcgcttgagatggattaattatttgag 262


>gnl|LJGI|BW624444 homologue to UniRef100_A7PCT7 Cluster: Chromosome chr17
           scaffold_12, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr17 scaffold_12, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (19%)
          Length = 487

 Score = 61.9 bits (31), Expect = 8e-09
 Identities = 76/91 (83%)
 Strand = Plus / Plus

                                                                       
Query: 119 gttctcttcccaaacaagctgggcttcagagatgtgggaaaagttgtcgtttgagatgga 178
           ||||| |||||||||||||||| || || |||||||| || |||||  | ||||||||||
Sbjct: 391 gttctgttcccaaacaagctggactgcaaagatgtggaaagagttgcaggttgagatgga 450

                                          
Query: 179 tcaattatctgaggccagatgtgaagagagg 209
           | || ||  ||||||| ||| ||||||||||
Sbjct: 451 taaactacttgaggcctgatttgaagagagg 481


>gnl|LJGI|TC75066 similar to UniRef100_A7Q1U0 Cluster: Chromosome chr7 scaffold_44,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr7 scaffold_44, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (43%)
          Length = 762

 Score = 58.0 bits (29), Expect = 1e-07
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 101 atggccatgagaattggcgttctcttcccaaacaagctggg 141
           |||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 212 atggccatgccaattggcgtgctcttcccaaacaagctggg 252


>gnl|LJGI|TC62535 similar to UniRef100_A7Q8B3 Cluster: Chromosome chr14 scaffold_63,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr14 scaffold_63, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (65%)
          Length = 1350

 Score = 58.0 bits (29), Expect = 1e-07
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                       
Query: 262 ggaaacaagtggtcaaagattgcatctcttttgcctggtaggactgacaatgagatcaag 321
           |||||||  ||||| |||||||| |||| | | ||||| || ||||| ||||||||||||
Sbjct: 407 ggaaacagatggtctaagattgcttctcatctccctggaagaactgataatgagatcaag 466

                                        
Query: 322 aacgtgtggaacacccacttaaagaaaaa 350
           |||   ||||| |||||| ||||||||||
Sbjct: 467 aaccactggaatacccacataaagaaaaa 495


>gnl|LJGI|TC69494 UniRef100_Q84PP4 Cluster: Transcription factor MYB102; n=1; Lotus
           japonicus|Rep: Transcription factor MYB102 - Lotus
           japonicus, complete
          Length = 1245

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 304 actgacaatgagatcaagaacgtgtggaacacccacttaaagaaaaa 350
           ||||||||||||||||||||  | |||||||| || |||||||||||
Sbjct: 329 actgacaatgagatcaagaatttttggaacactcatttaaagaaaaa 375


>gnl|LJGI|BW599880 similar to UniRef100_Q9S7E3 Cluster: GmMYB29A1 protein; n=1;
           Glycine max|Rep: GmMYB29A1 protein - Glycine max
           (Soybean), partial (40%)
          Length = 435

 Score = 52.0 bits (26), Expect = 7e-06
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                         
Query: 304 actgacaatgagatcaagaacgtgtggaacacccacttaaagaaaa 349
           ||||||||||| || ||||| |||||| |||||||||| |||||||
Sbjct: 389 actgacaatgaaataaagaatgtgtggcacacccacttgaagaaaa 434


>gnl|LJGI|TC81472 homologue to UniRef100_Q2LME4 Cluster: MYB20; n=1; Malus x
           domestica|Rep: MYB20 - Malus domestica (Apple) (Malus
           sylvestris), partial (42%)
          Length = 1348

 Score = 52.0 bits (26), Expect = 7e-06
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 145 cagagatgtgggaaaagttgtcgtttgagatggatcaattatctgaggcc 194
           |||||||||||||||||||||||  |  |||||||||||||  |||||||
Sbjct: 194 cagagatgtgggaaaagttgtcggcttcgatggatcaattacttgaggcc 243


>gnl|LJGI|TC62351 similar to UniRef100_Q0PJJ9 Cluster: MYB transcription factor
           MYB92; n=2; Glycine max|Rep: MYB transcription factor
           MYB92 - Glycine max (Soybean), partial (60%)
          Length = 1128

 Score = 52.0 bits (26), Expect = 7e-06
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 124 cttcccaaacaagctgggcttcagagatgtgggaaaagttgtcgtttgagatggatcaat 183
           ||||||||| |||||||||||| ||||||||| || |||||  |  | |||||||| || 
Sbjct: 208 cttcccaaaaaagctgggcttctgagatgtggaaagagttgcagactaagatggatgaac 267

                         
Query: 184 tatctgaggccaga 197
           |||||||| |||||
Sbjct: 268 tatctgagaccaga 281


>gnl|LJGI|TC57493 similar to UniRef100_A2Q4I4 Cluster: Homeodomain-related; n=1;
           Medicago truncatula|Rep: Homeodomain-related - Medicago
           truncatula (Barrel medic), partial (22%)
          Length = 1688

 Score = 52.0 bits (26), Expect = 7e-06
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 295 cctggtaggactgacaatgagatcaagaac 324
           ||||| ||||||||||||||||||||||||
Sbjct: 495 cctggcaggactgacaatgagatcaagaac 524