Miyakogusa Predicted Gene
- Lj3g3v0948220.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v0948220.1 tr|G7IGW8|G7IGW8_MEDTR Transcription factor Myb
OS=Medicago truncatula GN=MTR_2g064160 PE=4 SV=1,66.05,0,SANT SWI3,
ADA2, N-CoR and TFIIIB'' DNA-bin,SANT/Myb domain; MYB DNA BINDING /
TRANSCRIPTION FACTOR,CUFF.41731.1
(939 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|NP675421 GB|AB108650.1|BAC75673.1 transcription factor ... 70 3e-11
gnl|LJGI|BW624444 homologue to UniRef100_A7PCT7 Cluster: Chromos... 66 4e-10
gnl|LJGI|GO026297 homologue to UniRef100_Q0PJD6 Cluster: MYB tra... 64 2e-09
gnl|LJGI|TC65278 UniRef100_A7BJW2 Cluster: MYB-related protein; ... 64 2e-09
gnl|LJGI|TC68915 homologue to UniRef100_Q2LME0 Cluster: MYB24; n... 58 1e-07
gnl|LJGI|TC62351 similar to UniRef100_Q0PJJ9 Cluster: MYB transc... 58 1e-07
gnl|LJGI|TC62535 similar to UniRef100_A7Q8B3 Cluster: Chromosome... 54 2e-06
gnl|LJGI|FS344049 homologue to UniRef100_Q9XIU5 Cluster: GmMYB29... 52 6e-06
gnl|LJGI|TC58498 similar to UniRef100_Q9XIU5 Cluster: GmMYB29B2 ... 52 6e-06
>gnl|LJGI|NP675421 GB|AB108650.1|BAC75673.1 transcription factor MYB103 [Lotus
japonicus]
Length = 924
Score = 69.9 bits (35), Expect = 3e-11
Identities = 53/59 (89%)
Strand = Plus / Plus
Query: 142 tgtggaaagagttgcagattgagatggattaattatctgaggcctgatctcaagagggg 200
||||||||||||||||| | || |||| ||||||||||||||||||| ||||||||||
Sbjct: 145 tgtggaaagagttgcaggctaaggtggactaattatctgaggcctgatatcaagagggg 203
>gnl|LJGI|BW624444 homologue to UniRef100_A7PCT7 Cluster: Chromosome chr17
scaffold_12, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr17 scaffold_12, whole genome
shotgun sequence - Vitis vinifera (Grape), partial (19%)
Length = 487
Score = 65.9 bits (33), Expect = 4e-10
Identities = 60/69 (86%)
Strand = Plus / Plus
Query: 134 tgcagagatgtggaaagagttgcagattgagatggattaattatctgaggcctgatctca 193
|||| |||||||||||||||||||| ||||||||||| || || ||||||||||| | |
Sbjct: 415 tgcaaagatgtggaaagagttgcaggttgagatggataaactacttgaggcctgatttga 474
Query: 194 agaggggca 202
|||| ||||
Sbjct: 475 agagaggca 483
>gnl|LJGI|GO026297 homologue to UniRef100_Q0PJD6 Cluster: MYB transcription factor
MYB160; n=1; Glycine max|Rep: MYB transcription factor
MYB160 - Glycine max (Soybean), partial (60%)
Length = 351
Score = 63.9 bits (32), Expect = 2e-09
Identities = 116/144 (80%)
Strand = Plus / Plus
Query: 46 tggtctcctgaagaagatgaaaagcttctaaaatatatcaccattcatggccataaaagt 105
|||||||| || |||||||||||||| | || | ||||||| ||||||||| | |
Sbjct: 21 tggtctccagaggaagatgaaaagctcttgaatcacatcaccaaacatggccatggatgc 80
Query: 106 tggagttctgttccaaagttagcaggcttgcagagatgtggaaagagttgcagattgaga 165
||||| || || ||||| |||| || |||||||| ||||| ||||| ||||| |||||
Sbjct: 81 tggagctccgtcccaaaactagctggtttgcagaggtgtgggaagagctgcaggttgagg 140
Query: 166 tggattaattatctgaggcctgat 189
||||| ||||| ||||||||||||
Sbjct: 141 tggataaattacctgaggcctgat 164
>gnl|LJGI|TC65278 UniRef100_A7BJW2 Cluster: MYB-related protein; n=1; Lotus
japonicus|Rep: MYB-related protein - Lotus japonicus,
complete
Length = 1201
Score = 63.9 bits (32), Expect = 2e-09
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 139 agatgtggaaagagttgcagattgagatggattaattatctgag 182
|||||||| |||||||||||||||||||||||||| ||| ||||
Sbjct: 292 agatgtgggaagagttgcagattgagatggattaactatttgag 335
>gnl|LJGI|TC68915 homologue to UniRef100_Q2LME0 Cluster: MYB24; n=1; Malus x
domestica|Rep: MYB24 - Malus domestica (Apple) (Malus
sylvestris), partial (38%)
Length = 1263
Score = 58.0 bits (29), Expect = 1e-07
Identities = 44/49 (89%)
Strand = Plus / Plus
Query: 137 agagatgtggaaagagttgcagattgagatggattaattatctgaggcc 185
||||||||||||| |||||||||||||||||| | || ||||| |||||
Sbjct: 195 agagatgtggaaaaagttgcagattgagatggctcaactatcttaggcc 243
>gnl|LJGI|TC62351 similar to UniRef100_Q0PJJ9 Cluster: MYB transcription factor
MYB92; n=2; Glycine max|Rep: MYB transcription factor
MYB92 - Glycine max (Soybean), partial (60%)
Length = 1128
Score = 58.0 bits (29), Expect = 1e-07
Identities = 41/45 (91%)
Strand = Plus / Plus
Query: 138 gagatgtggaaagagttgcagattgagatggattaattatctgag 182
|||||||||||||||||||||| | |||||||| || ||||||||
Sbjct: 231 gagatgtggaaagagttgcagactaagatggatgaactatctgag 275
>gnl|LJGI|TC62535 similar to UniRef100_A7Q8B3 Cluster: Chromosome chr14 scaffold_63,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr14 scaffold_63, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (65%)
Length = 1350
Score = 54.0 bits (27), Expect = 2e-06
Identities = 33/35 (94%)
Strand = Plus / Plus
Query: 280 catctccctggaagaacagataatgaggtcaagaa 314
||||||||||||||||| ||||||||| |||||||
Sbjct: 434 catctccctggaagaactgataatgagatcaagaa 468
>gnl|LJGI|FS344049 homologue to UniRef100_Q9XIU5 Cluster: GmMYB29B2 protein; n=1;
Glycine max|Rep: GmMYB29B2 protein - Glycine max
(Soybean), partial (32%)
Length = 703
Score = 52.0 bits (26), Expect = 6e-06
Identities = 68/82 (82%)
Strand = Plus / Plus
Query: 116 ttccaaagttagcaggcttgcagagatgtggaaagagttgcagattgagatggattaatt 175
|||||||| |||||||||| || ||||| ||||| |||||| || | |||||||| |
Sbjct: 224 ttccaaagcaagcaggcttgttaaggtgtgggaagagctgcagactgcgctggattaact 283
Query: 176 atctgaggcctgatctcaagag 197
|| ||||||||||| |||||||
Sbjct: 284 atttgaggcctgatatcaagag 305
>gnl|LJGI|TC58498 similar to UniRef100_Q9XIU5 Cluster: GmMYB29B2 protein; n=1;
Glycine max|Rep: GmMYB29B2 protein - Glycine max
(Soybean), partial (81%)
Length = 1373
Score = 52.0 bits (26), Expect = 6e-06
Identities = 68/82 (82%)
Strand = Plus / Plus
Query: 116 ttccaaagttagcaggcttgcagagatgtggaaagagttgcagattgagatggattaatt 175
|||||||| |||||||||| || ||||| ||||| |||||| || | |||||||| |
Sbjct: 257 ttccaaagcaagcaggcttgttaaggtgtgggaagagctgcagactgcgctggattaact 316
Query: 176 atctgaggcctgatctcaagag 197
|| ||||||||||| |||||||
Sbjct: 317 atttgaggcctgatatcaagag 338