Miyakogusa Predicted Gene

Lj3g3v0948220.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v0948220.1 tr|G7IGW8|G7IGW8_MEDTR Transcription factor Myb
OS=Medicago truncatula GN=MTR_2g064160 PE=4 SV=1,66.05,0,SANT  SWI3,
ADA2, N-CoR and TFIIIB'' DNA-bin,SANT/Myb domain; MYB DNA BINDING /
TRANSCRIPTION FACTOR,CUFF.41731.1
         (939 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|NP675421 GB|AB108650.1|BAC75673.1 transcription factor ...    70   3e-11
gnl|LJGI|BW624444 homologue to UniRef100_A7PCT7 Cluster: Chromos...    66   4e-10
gnl|LJGI|GO026297 homologue to UniRef100_Q0PJD6 Cluster: MYB tra...    64   2e-09
gnl|LJGI|TC65278 UniRef100_A7BJW2 Cluster: MYB-related protein; ...    64   2e-09
gnl|LJGI|TC68915 homologue to UniRef100_Q2LME0 Cluster: MYB24; n...    58   1e-07
gnl|LJGI|TC62351 similar to UniRef100_Q0PJJ9 Cluster: MYB transc...    58   1e-07
gnl|LJGI|TC62535 similar to UniRef100_A7Q8B3 Cluster: Chromosome...    54   2e-06
gnl|LJGI|FS344049 homologue to UniRef100_Q9XIU5 Cluster: GmMYB29...    52   6e-06
gnl|LJGI|TC58498 similar to UniRef100_Q9XIU5 Cluster: GmMYB29B2 ...    52   6e-06

>gnl|LJGI|NP675421 GB|AB108650.1|BAC75673.1 transcription factor MYB103 [Lotus
           japonicus]
          Length = 924

 Score = 69.9 bits (35), Expect = 3e-11
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 142 tgtggaaagagttgcagattgagatggattaattatctgaggcctgatctcaagagggg 200
           |||||||||||||||||  | || |||| ||||||||||||||||||| ||||||||||
Sbjct: 145 tgtggaaagagttgcaggctaaggtggactaattatctgaggcctgatatcaagagggg 203


>gnl|LJGI|BW624444 homologue to UniRef100_A7PCT7 Cluster: Chromosome chr17
           scaffold_12, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr17 scaffold_12, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (19%)
          Length = 487

 Score = 65.9 bits (33), Expect = 4e-10
 Identities = 60/69 (86%)
 Strand = Plus / Plus

                                                                       
Query: 134 tgcagagatgtggaaagagttgcagattgagatggattaattatctgaggcctgatctca 193
           |||| |||||||||||||||||||| ||||||||||| || ||  ||||||||||| | |
Sbjct: 415 tgcaaagatgtggaaagagttgcaggttgagatggataaactacttgaggcctgatttga 474

                    
Query: 194 agaggggca 202
           |||| ||||
Sbjct: 475 agagaggca 483


>gnl|LJGI|GO026297 homologue to UniRef100_Q0PJD6 Cluster: MYB transcription factor
           MYB160; n=1; Glycine max|Rep: MYB transcription factor
           MYB160 - Glycine max (Soybean), partial (60%)
          Length = 351

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 116/144 (80%)
 Strand = Plus / Plus

                                                                       
Query: 46  tggtctcctgaagaagatgaaaagcttctaaaatatatcaccattcatggccataaaagt 105
           |||||||| || ||||||||||||||  | ||  | |||||||  |||||||||  | | 
Sbjct: 21  tggtctccagaggaagatgaaaagctcttgaatcacatcaccaaacatggccatggatgc 80

                                                                       
Query: 106 tggagttctgttccaaagttagcaggcttgcagagatgtggaaagagttgcagattgaga 165
           ||||| || || |||||  |||| || |||||||| ||||| ||||| ||||| ||||| 
Sbjct: 81  tggagctccgtcccaaaactagctggtttgcagaggtgtgggaagagctgcaggttgagg 140

                                   
Query: 166 tggattaattatctgaggcctgat 189
           ||||| ||||| ||||||||||||
Sbjct: 141 tggataaattacctgaggcctgat 164


>gnl|LJGI|TC65278 UniRef100_A7BJW2 Cluster: MYB-related protein; n=1; Lotus
           japonicus|Rep: MYB-related protein - Lotus japonicus,
           complete
          Length = 1201

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                       
Query: 139 agatgtggaaagagttgcagattgagatggattaattatctgag 182
           |||||||| |||||||||||||||||||||||||| ||| ||||
Sbjct: 292 agatgtgggaagagttgcagattgagatggattaactatttgag 335


>gnl|LJGI|TC68915 homologue to UniRef100_Q2LME0 Cluster: MYB24; n=1; Malus x
           domestica|Rep: MYB24 - Malus domestica (Apple) (Malus
           sylvestris), partial (38%)
          Length = 1263

 Score = 58.0 bits (29), Expect = 1e-07
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 137 agagatgtggaaagagttgcagattgagatggattaattatctgaggcc 185
           ||||||||||||| |||||||||||||||||| | || ||||| |||||
Sbjct: 195 agagatgtggaaaaagttgcagattgagatggctcaactatcttaggcc 243


>gnl|LJGI|TC62351 similar to UniRef100_Q0PJJ9 Cluster: MYB transcription factor
           MYB92; n=2; Glycine max|Rep: MYB transcription factor
           MYB92 - Glycine max (Soybean), partial (60%)
          Length = 1128

 Score = 58.0 bits (29), Expect = 1e-07
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 138 gagatgtggaaagagttgcagattgagatggattaattatctgag 182
           |||||||||||||||||||||| | |||||||| || ||||||||
Sbjct: 231 gagatgtggaaagagttgcagactaagatggatgaactatctgag 275


>gnl|LJGI|TC62535 similar to UniRef100_A7Q8B3 Cluster: Chromosome chr14 scaffold_63,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr14 scaffold_63, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (65%)
          Length = 1350

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 280 catctccctggaagaacagataatgaggtcaagaa 314
           ||||||||||||||||| ||||||||| |||||||
Sbjct: 434 catctccctggaagaactgataatgagatcaagaa 468


>gnl|LJGI|FS344049 homologue to UniRef100_Q9XIU5 Cluster: GmMYB29B2 protein; n=1;
           Glycine max|Rep: GmMYB29B2 protein - Glycine max
           (Soybean), partial (32%)
          Length = 703

 Score = 52.0 bits (26), Expect = 6e-06
 Identities = 68/82 (82%)
 Strand = Plus / Plus

                                                                       
Query: 116 ttccaaagttagcaggcttgcagagatgtggaaagagttgcagattgagatggattaatt 175
           ||||||||  ||||||||||   || ||||| ||||| |||||| || | |||||||| |
Sbjct: 224 ttccaaagcaagcaggcttgttaaggtgtgggaagagctgcagactgcgctggattaact 283

                                 
Query: 176 atctgaggcctgatctcaagag 197
           || ||||||||||| |||||||
Sbjct: 284 atttgaggcctgatatcaagag 305


>gnl|LJGI|TC58498 similar to UniRef100_Q9XIU5 Cluster: GmMYB29B2 protein; n=1;
           Glycine max|Rep: GmMYB29B2 protein - Glycine max
           (Soybean), partial (81%)
          Length = 1373

 Score = 52.0 bits (26), Expect = 6e-06
 Identities = 68/82 (82%)
 Strand = Plus / Plus

                                                                       
Query: 116 ttccaaagttagcaggcttgcagagatgtggaaagagttgcagattgagatggattaatt 175
           ||||||||  ||||||||||   || ||||| ||||| |||||| || | |||||||| |
Sbjct: 257 ttccaaagcaagcaggcttgttaaggtgtgggaagagctgcagactgcgctggattaact 316

                                 
Query: 176 atctgaggcctgatctcaagag 197
           || ||||||||||| |||||||
Sbjct: 317 atttgaggcctgatatcaagag 338