Miyakogusa Predicted Gene
- Lj3g3v0936550.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v0936550.1 Non Chatacterized Hit- tr|I1MJH8|I1MJH8_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,79.22,0,DUF946,Vacuolar protein sorting-associated protein 62;
PRE-MRNA PROCESSING-RELATED,NULL; PRE-MRNA PR,CUFF.41655.1
(1311 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC72947 weakly similar to UniRef100_A7QR76 Cluster: Chr... 86 6e-16
gnl|LJGI|TC73903 similar to UniRef100_A7QR76 Cluster: Chromosome... 82 1e-14
gnl|LJGI|TC76424 weakly similar to UniRef100_O64861 Cluster: Exp... 74 2e-12
>gnl|LJGI|TC72947 weakly similar to UniRef100_A7QR76 Cluster: Chromosome chr13
scaffold_149, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr13 scaffold_149, whole
genome shotgun sequence - Vitis vinifera (Grape),
partial (68%)
Length = 1473
Score = 85.7 bits (43), Expect = 6e-16
Identities = 100/119 (84%)
Strand = Plus / Plus
Query: 169 ggctatatttggttaccaatagcccctaatggttacaaagctgtgggccatgttgtcaca 228
|||||| ||||| |||||| ||| ||| |||| ||||||||| | ||||||||||||||
Sbjct: 189 ggctatgtttggctaccaaaagcacctgatgggtacaaagctttaggccatgttgtcacc 248
Query: 229 acctcaccagaaaaaccttccctggacagaatcaggtgtgttagatcagacctcactga 287
||| |||| || ||||||||||| |||| ||||| |||||| || ||||||||||||
Sbjct: 249 accacacctgataaaccttcccttgacaaaatcaagtgtgtcaggcaagacctcactga 307
Score = 65.9 bits (33), Expect = 6e-10
Identities = 39/41 (95%)
Strand = Plus / Plus
Query: 571 ccttcctctgtggattggtttttcaccaatggggcattact 611
|||||||||||||||||||||||| ||||||| ||||||||
Sbjct: 591 ccttcctctgtggattggtttttctccaatggagcattact 631
Score = 54.0 bits (27), Expect = 2e-06
Identities = 33/35 (94%)
Strand = Plus / Plus
Query: 916 gattgggagcatgtcacattaagggtgagcaattt 950
|||||||||||||||||||||||| | ||||||||
Sbjct: 930 gattgggagcatgtcacattaaggatcagcaattt 964
>gnl|LJGI|TC73903 similar to UniRef100_A7QR76 Cluster: Chromosome chr13 scaffold_149,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr13 scaffold_149, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (46%)
Length = 1053
Score = 81.8 bits (41), Expect = 1e-14
Identities = 86/101 (85%)
Strand = Plus / Plus
Query: 904 gaacacgtgggggattgggagcatgtcacattaagggtgagcaatttcagtggagaattg 963
|||||||||||||| ||||| ||||| ||||| ||||| |||||||||| |||||| |||
Sbjct: 291 gaacacgtgggggactgggaacatgtgacattgagggtcagcaatttcaatggagagttg 350
Query: 964 tggagggtttatttctcacaacacagcaagggtcagtgggt 1004
|| |||| ||||||||||||||| || ||||| |||||
Sbjct: 351 aagaaagtttttttctcacaacacagtaatggtcaatgggt 391
Score = 54.0 bits (27), Expect = 2e-06
Identities = 60/71 (84%)
Strand = Plus / Plus
Query: 782 ttcatgttaagcccatgctaggtggaacattcactgacattgtgatgtggattttctacc 841
||||||| || |||||| | ||||||||||||||||| | | |||||||||||||| |
Sbjct: 166 ttcatgtgaaacccatgtttggtggaacattcactgatctagccatgtggattttctatc 225
Query: 842 catttaatggt 852
|||| ||||||
Sbjct: 226 cattcaatggt 236
>gnl|LJGI|TC76424 weakly similar to UniRef100_O64861 Cluster: Expressed protein; n=1;
Arabidopsis thaliana|Rep: Expressed protein -
Arabidopsis thaliana (Mouse-ear cress), partial (26%)
Length = 782
Score = 73.8 bits (37), Expect = 2e-12
Identities = 91/109 (83%)
Strand = Plus / Plus
Query: 176 tttggttaccaatagcccctaatggttacaaagctgtgggccatgttgtcacaacctcac 235
|||||||||||| ||| ||| |||| || ||| | | |||||||||||||| ||| ||
Sbjct: 457 tttggttaccaacagcacctgatggctataaatccttaggccatgttgtcaccaccacag 516
Query: 236 cagaaaaaccttccctggacagaatcaggtgtgttagatcagacctcac 284
|||| || |||||||| ||||||||||||||||| || ||||| |||||
Sbjct: 517 cagagaagccttcccttgacagaatcaggtgtgtcaggtcagatctcac 565