Miyakogusa Predicted Gene

Lj3g3v0883670.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v0883670.1 Non Chatacterized Hit- tr|I1L4F5|I1L4F5_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max PE=4,68.82,0,C2
domain (Calcium/lipid-binding domain, CaLB),C2 calcium/lipid-binding
domain, CaLB; no description,gene.g46270.t1.1
         (2331 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC72951 homologue to UniRef100_A2Q4U9 Cluster: C2; n=1;...   100   8e-20
gnl|LJGI|TC82078 homologue to UniRef100_Q0TV71 Cluster: Anthrani...    90   7e-17

>gnl|LJGI|TC72951 homologue to UniRef100_A2Q4U9 Cluster: C2; n=1; Medicago
            truncatula|Rep: C2 - Medicago truncatula (Barrel medic),
            partial (14%)
          Length = 582

 Score = 99.6 bits (50), Expect = 8e-20
 Identities = 86/98 (87%)
 Strand = Plus / Plus

                                                                        
Query: 2089 ttggcaactcaaggagagaggtttcagtcccttctcagctggagggatccaagggcaact 2148
            ||||| |||||||| |||||||| |||||  | ||||||||||| |||||||| || |||
Sbjct: 82   ttggccactcaaggggagaggttgcagtctttgctcagctggagagatccaagagccact 141

                                                  
Query: 2149 tctctgtttgtgattttctgtttggtttctgccattgt 2186
             | |||||||||||||||||||||||| ||||||||||
Sbjct: 142  gcactgtttgtgattttctgtttggttgctgccattgt 179


>gnl|LJGI|TC82078 homologue to UniRef100_Q0TV71 Cluster: Anthranilate
            phosphoribosyltransferase-like protein; n=1; Arabidopsis
            thaliana|Rep: Anthranilate phosphoribosyltransferase-like
            protein - Arabidopsis thaliana (Mouse-ear cress), partial
            (16%)
          Length = 369

 Score = 89.7 bits (45), Expect = 7e-17
 Identities = 63/69 (91%)
 Strand = Plus / Plus

                                                                        
Query: 1224 gtggaatgagcagtacacttgggaggtttatgatccttgcactgtcatcacagttgttgt 1283
            ||||||||||||||||||||||||||| | |||||||||||||||||| ||| ||| |||
Sbjct: 193  gtggaatgagcagtacacttgggaggtctttgatccttgcactgtcattacacttggtgt 252

                     
Query: 1284 gtttgataa 1292
             ||||||||
Sbjct: 253  atttgataa 261