Miyakogusa Predicted Gene

Lj3g3v0839400.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v0839400.1 Non Chatacterized Hit- tr|C5YP75|C5YP75_SORBI
Putative uncharacterized protein Sb08g016620
OS=Sorghu,41.67,0.014,SANT  SWI3, ADA2, N-CoR and TFIIIB''
DNA-bin,SANT/Myb domain; Myb_DNA-binding,SANT/Myb domain;
Homeo,CUFF.41577.1
         (1059 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC81472 homologue to UniRef100_Q2LME4 Cluster: MYB20; n...   123   2e-27
gnl|LJGI|TC69812 homologue to UniRef100_Q0PJI3 Cluster: MYB tran...    58   1e-07
gnl|LJGI|TC63582 homologue to UniRef100_Q0PJI3 Cluster: MYB tran...    58   1e-07
gnl|LJGI|TC62535 similar to UniRef100_A7Q8B3 Cluster: Chromosome...    58   1e-07
gnl|LJGI|FS328706 similar to UniRef100_A7Q0Y1 Cluster: Chromosom...    54   2e-06

>gnl|LJGI|TC81472 homologue to UniRef100_Q2LME4 Cluster: MYB20; n=1; Malus x
           domestica|Rep: MYB20 - Malus domestica (Apple) (Malus
           sylvestris), partial (42%)
          Length = 1348

 Score =  123 bits (62), Expect = 2e-27
 Identities = 242/302 (80%)
 Strand = Plus / Plus

                                                                       
Query: 88  aagcttaggaaggggttatggtcacctgaggaagatgaaaagcttctgaggtacatgata 147
           |||||||| |||||||| |||||||| ||||||||||| |||||  |||  |||||| ||
Sbjct: 86  aagcttagaaaggggttgtggtcaccagaggaagatgacaagctcatgaactacatgtta 145

                                                                       
Query: 148 actaagggacaagggtgctggagtgacattgctaggaatgctggtcttcagagatgtggt 207
           |     |||||||| || ||||| ||  | || || ||||||||| | ||||||||||| 
Sbjct: 146 aactctggacaaggttgttggagcgatgtggccagaaatgctggtttgcagagatgtggg 205

                                                                       
Query: 208 aaaagctgtcgtctccgttggattaattacttgagacctgatctcaagcgcggcgcattt 267
           ||||| ||||| || || ||||| ||||||||||| |||||||| || || || || | |
Sbjct: 206 aaaagttgtcggcttcgatggatcaattacttgaggcctgatcttaaacgaggtgcttct 265

                                                                       
Query: 268 tcgccacaggaggaagatctcatcgttcatttacactccattcttggaaacagatggtct 327
           ||||| || || || || |||||| | ||||| || ||| ||||||||||||||||||||
Sbjct: 266 tcgcctcaagaagaggaactcatcatccatttgcattcccttcttggaaacagatggtct 325

                                                                       
Query: 328 cagattgctgcacgtctccctggtcgcacagacaatgagatcaagaatttctggaactcc 387
           || ||||| |||||  | |||||  | || ||||||||||| ||||| || ||||| |||
Sbjct: 326 caaattgcggcacgcttacctgggagaactgacaatgagattaagaacttttggaattcc 385

             
Query: 388 ac 389
           ||
Sbjct: 386 ac 387


>gnl|LJGI|TC69812 homologue to UniRef100_Q0PJI3 Cluster: MYB transcription factor
           MYB139; n=1; Glycine max|Rep: MYB transcription factor
           MYB139 - Glycine max (Soybean), partial (64%)
          Length = 1148

 Score = 58.0 bits (29), Expect = 1e-07
 Identities = 35/37 (94%)
 Strand = Plus / Plus

                                                
Query: 346 cctggtcgcacagacaatgagatcaagaatttctgga 382
           ||||| ||||||||||||||||| |||||||||||||
Sbjct: 386 cctgggcgcacagacaatgagattaagaatttctgga 422


>gnl|LJGI|TC63582 homologue to UniRef100_Q0PJI3 Cluster: MYB transcription factor
           MYB139; n=1; Glycine max|Rep: MYB transcription factor
           MYB139 - Glycine max (Soybean), partial (56%)
          Length = 762

 Score = 58.0 bits (29), Expect = 1e-07
 Identities = 35/37 (94%)
 Strand = Plus / Plus

                                                
Query: 346 cctggtcgcacagacaatgagatcaagaatttctgga 382
           ||||| ||||||||||||||||| |||||||||||||
Sbjct: 454 cctgggcgcacagacaatgagattaagaatttctgga 490


>gnl|LJGI|TC62535 similar to UniRef100_A7Q8B3 Cluster: Chromosome chr14 scaffold_63,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr14 scaffold_63, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (65%)
          Length = 1350

 Score = 58.0 bits (29), Expect = 1e-07
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 310 cttggaaacagatggtctcagattgctgcacgtctccctggtcgcacagacaatgagatc 369
           |||||||||||||||||| |||||||| | | |||||||||  | || || |||||||||
Sbjct: 404 cttggaaacagatggtctaagattgcttctcatctccctggaagaactgataatgagatc 463

                
Query: 370 aagaa 374
           |||||
Sbjct: 464 aagaa 468


>gnl|LJGI|FS328706 similar to UniRef100_A7Q0Y1 Cluster: Chromosome chr7 scaffold_42,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr7 scaffold_42, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (35%)
          Length = 765

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 88  aagcttaggaaggggttatggtcacctgaggaagatgaaaagcttctgagg 138
           ||||||||||||||  | |||||||| ||||||||||| || |||||||||
Sbjct: 180 aagcttaggaagggtctgtggtcaccagaggaagatgagaaacttctgagg 230