Miyakogusa Predicted Gene

Lj3g3v0618200.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v0618200.1 tr|G7LDH4|G7LDH4_MEDTR Retrograde Golgi transport
protein RGP1-like protein OS=Medicago truncatula G,85.53,0,seg,NULL;
Rgp1,Reduced growth phenotype protein 1; SUBFAMILY NOT NAMED,NULL;
REDUCED GROWTH PHENOTYP,CUFF.41110.1
         (1596 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC58672 weakly similar to UniRef100_Q6GLC1 Cluster: LUC...    54   3e-06

>gnl|LJGI|TC58672 weakly similar to UniRef100_Q6GLC1 Cluster: LUC7-like; n=1; Xenopus
           tropicalis|Rep: LUC7-like - Xenopus tropicalis (Western
           clawed frog) (Silurana tropicalis), partial (7%)
          Length = 788

 Score = 54.0 bits (27), Expect = 3e-06
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 312 tccaatcctagttgcaaatcagattgtgaatgctggcaccagcaaat 358
           |||||||||||||||||  ||| ||||||||| ||||||||| ||||
Sbjct: 496 tccaatcctagttgcaatccaggttgtgaatggtggcaccagtaaat 542