Miyakogusa Predicted Gene

Lj3g3v0463690.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v0463690.1 Non Chatacterized Hit- tr|B4FF66|B4FF66_MAIZE
Uncharacterized protein OS=Zea mays PE=2 SV=2,60.23,4e-19,no
description,Homeodomain-like; seg,NULL; Homeobox,Homeodomain;
HOMEOBOX_2,Homeodomain; Homeodomain,CUFF.40854.1
         (702 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC72963 homologue to UniRef100_Q39862 Cluster: Homeobox...    78   8e-14
gnl|LJGI|BW598498 homologue to UniRef100_Q45RR3 Cluster: Type II...    70   2e-11
gnl|LJGI|TC68284 homologue to UniRef100_Q39862 Cluster: Homeobox...    70   2e-11
gnl|LJGI|TC73766 similar to UniRef100_Q45RR3 Cluster: Type II ho...    56   3e-07

>gnl|LJGI|TC72963 homologue to UniRef100_Q39862 Cluster: Homeobox-leucine zipper
           protein; n=1; Glycine max|Rep: Homeobox-leucine zipper
           protein - Glycine max (Soybean), partial (30%)
          Length = 635

 Score = 77.8 bits (39), Expect = 8e-14
 Identities = 42/43 (97%)
 Strand = Plus / Plus

                                                      
Query: 571 cttgaagaaagcttcaaagaccacaacactcttaaccctaaac 613
           |||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 593 cttgaagaaagcttcaaagaacacaacactcttaaccctaaac 635


>gnl|LJGI|BW598498 homologue to UniRef100_Q45RR3 Cluster: Type II homeodomain-leucine
           zipper protein; n=1; Medicago sativa|Rep: Type II
           homeodomain-leucine zipper protein - Medicago sativa
           (Alfalfa), partial (26%)
          Length = 487

 Score = 69.9 bits (35), Expect = 2e-11
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 648 ccctcgccaaatagaagtatggtttcaaaacagaagagcaaggaccaagctgaag 702
           |||||| ||| ||||||| ||||| |||||||||||||||||||| |||||||||
Sbjct: 11  ccctcgacaagtagaagtctggttccaaaacagaagagcaaggactaagctgaag 65


>gnl|LJGI|TC68284 homologue to UniRef100_Q39862 Cluster: Homeobox-leucine zipper
           protein; n=1; Glycine max|Rep: Homeobox-leucine zipper
           protein - Glycine max (Soybean), partial (29%)
          Length = 716

 Score = 69.9 bits (35), Expect = 2e-11
 Identities = 38/39 (97%)
 Strand = Plus / Plus

                                                  
Query: 571 cttgaagaaagcttcaaagaccacaacactcttaaccct 609
           |||||||||||||||||||| ||||||||||||||||||
Sbjct: 587 cttgaagaaagcttcaaagaacacaacactcttaaccct 625


>gnl|LJGI|TC73766 similar to UniRef100_Q45RR3 Cluster: Type II homeodomain-leucine
           zipper protein; n=1; Medicago sativa|Rep: Type II
           homeodomain-leucine zipper protein - Medicago sativa
           (Alfalfa), partial (12%)
          Length = 542

 Score = 56.0 bits (28), Expect = 3e-07
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 432 ggaggatgaggccgaggaagaggcggcgctgtcatc 467
           |||||||||||| ||||||| |||||||||||||||
Sbjct: 478 ggaggatgaggcggaggaaggggcggcgctgtcatc 513