Miyakogusa Predicted Gene
- Lj3g3v0461020.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v0461020.1 Non Chatacterized Hit- tr|I1JJZ5|I1JJZ5_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.5430
PE=,77.44,0,seg,NULL; Thioredoxin,Thioredoxin domain;
THIOREDOXIN_1,Thioredoxin, conserved site;
Thioredoxin-lik,NODE_89410_length_691_cov_21.512300.path2.1
(471 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC67595 similar to UniRef100_Q8H6X3 Cluster: Thioredoxi... 285 1e-76
gnl|LJGI|TC58009 similar to UniRef100_Q8H6X3 Cluster: Thioredoxi... 285 1e-76
gnl|LJGI|AV767114 similar to UniRef100_Q8H6X3 Cluster: Thioredox... 254 4e-67
>gnl|LJGI|TC67595 similar to UniRef100_Q8H6X3 Cluster: Thioredoxin h-like protein;
n=1; Nicotiana tabacum|Rep: Thioredoxin h-like protein -
Nicotiana tabacum (Common tobacco), partial (79%)
Length = 802
Score = 285 bits (144), Expect = 1e-76
Identities = 258/296 (87%)
Strand = Plus / Plus
Query: 137 ttattactaccaaagaatcttgggaccaaaagttggaacaagcaaggagagatggaaaag 196
||||||| ||||||||| |||||||||||||||||||| |||| | ||| ||||| |||
Sbjct: 223 ttattaccaccaaagaagcttgggaccaaaagttggaagaagccaagagggatggcaaaa 282
Query: 197 ttgttgttgcaaatttcagtgcaacatggtgtggtccttgcaagacgattgcaccttgtt 256
|||| ||||||||||||||||||||||||||||||||||||||| |||||||| | ||
Sbjct: 283 ttgtgattgcaaatttcagtgcaacatggtgtggtccttgcaagataattgcaccatatt 342
Query: 257 attgcgagttatcagagaaatacccatctattatgttcttagtagtggatgtggacgaat 316
| ||||||||||| ||||| ||| ||||||| ||||||||| |||| |||||||| |||
Sbjct: 343 actgcgagttatctgagaagtacacatctatgatgttcttattagttgatgtggatgaac 402
Query: 317 taactgacttcagcacttcctggaacatcaaagctacaccaacgttcttctttcttagag 376
||||||||||||||||||| ||| |||||||||| || || || ||||||||||||| ||
Sbjct: 403 taactgacttcagcacttcatgggacatcaaagccacccctactttcttctttcttaaag 462
Query: 377 atggacaagagattgacaaattaataggagccaacaagccagagctggagaagaag 432
|||| ||| | |||||||| | |||||||||||| |||||||||||||||||||
Sbjct: 463 atgggcaacaacttgacaaactcgtaggagccaacaggccagagctggagaagaag 518
>gnl|LJGI|TC58009 similar to UniRef100_Q8H6X3 Cluster: Thioredoxin h-like protein;
n=1; Nicotiana tabacum|Rep: Thioredoxin h-like protein -
Nicotiana tabacum (Common tobacco), partial (79%)
Length = 840
Score = 285 bits (144), Expect = 1e-76
Identities = 258/296 (87%)
Strand = Plus / Plus
Query: 137 ttattactaccaaagaatcttgggaccaaaagttggaacaagcaaggagagatggaaaag 196
||||||| ||||||||| |||||||||||||||||||| |||| | ||| ||||| |||
Sbjct: 286 ttattaccaccaaagaagcttgggaccaaaagttggaagaagccaagagggatggcaaaa 345
Query: 197 ttgttgttgcaaatttcagtgcaacatggtgtggtccttgcaagacgattgcaccttgtt 256
|||| ||||||||||||||||||||||||||||||||||||||| |||||||| | ||
Sbjct: 346 ttgtgattgcaaatttcagtgcaacatggtgtggtccttgcaagataattgcaccatatt 405
Query: 257 attgcgagttatcagagaaatacccatctattatgttcttagtagtggatgtggacgaat 316
| ||||||||||| ||||| ||| ||||||| ||||||||| |||| |||||||| |||
Sbjct: 406 actgcgagttatctgagaagtacacatctatgatgttcttattagttgatgtggatgaac 465
Query: 317 taactgacttcagcacttcctggaacatcaaagctacaccaacgttcttctttcttagag 376
||||||||||||||||||| ||| |||||||||| || || || ||||||||||||| ||
Sbjct: 466 taactgacttcagcacttcatgggacatcaaagccacccctactttcttctttcttaaag 525
Query: 377 atggacaagagattgacaaattaataggagccaacaagccagagctggagaagaag 432
|||| ||| | |||||||| | |||||||||||| |||||||||||||||||||
Sbjct: 526 atgggcaacaacttgacaaactcgtaggagccaacaggccagagctggagaagaag 581
>gnl|LJGI|AV767114 similar to UniRef100_Q8H6X3 Cluster: Thioredoxin h-like protein;
n=1; Nicotiana tabacum|Rep: Thioredoxin h-like protein -
Nicotiana tabacum (Common tobacco), partial (63%)
Length = 585
Score = 254 bits (128), Expect = 4e-67
Identities = 236/272 (86%)
Strand = Plus / Minus
Query: 161 accaaaagttggaacaagcaaggagagatggaaaagttgttgttgcaaatttcagtgcaa 220
|||||||||||||| |||| | ||| ||||| ||| |||| ||||||||||||||||||
Sbjct: 585 accaaaagttggaagaagccaagagggatggcaaaattgtgattgcaaatttcagtgcaa 526
Query: 221 catggtgtggtccttgcaagacgattgcaccttgttattgcgagttatcagagaaatacc 280
||||||||||||||||||||| |||||||| | ||| ||||||||||| ||||| |||
Sbjct: 525 catggtgtggtccttgcaagataattgcaccatattactgcgagttatctgagaagtaca 466
Query: 281 catctattatgttcttagtagtggatgtggacgaattaactgacttcagcacttcctgga 340
||||||| ||||||||| |||| |||||||| ||| ||||||||||||||||||| |||
Sbjct: 465 catctatgatgttcttattagttgatgtggatgaactaactgacttcagcacttcatggg 406
Query: 341 acatcaaagctacaccaacgttcttctttcttagagatggacaagagattgacaaattaa 400
|||||||||| || || || ||||||||||||| |||||| ||| | |||||||| |
Sbjct: 405 acatcaaagccacccctactttcttctttcttaaagatgggcaacaacttgacaaactcg 346
Query: 401 taggagccaacaagccagagctggagaagaag 432
|||||||||||| |||||||||||||||||||
Sbjct: 345 taggagccaacaggccagagctggagaagaag 314