Miyakogusa Predicted Gene

Lj3g3v0429710.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v0429710.1 Non Chatacterized Hit- tr|I3S192|I3S192_MEDTR
Uncharacterized protein OS=Medicago truncatula PE=2
SV,79.19,0,Branch,Glycosyl transferase, family 14; GLYCOSYLATION
ENZYME-LIKE PROTEIN,NULL; GLYCOSYLTRANSFERASE ,78957_g.1
         (448 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC75712 similar to UniRef100_Q5BM97 Cluster: Secondary ...    54   8e-07

>gnl|LJGI|TC75712 similar to UniRef100_Q5BM97 Cluster: Secondary cell wall-related
           glycosyltransferase family 14; n=1; Populus tremula x
           Populus tremuloides|Rep: Secondary cell wall-related
           glycosyltransferase family 14 - Populus tremula x
           Populus tremuloides, partial (40%)
          Length = 772

 Score = 54.0 bits (27), Expect = 8e-07
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 314 tggtcacttacagaggaccaacaatggttgc 344
           |||||||||||||||||||||||||| ||||
Sbjct: 506 tggtcacttacagaggaccaacaatgcttgc 536