Miyakogusa Predicted Gene
- Lj3g3v0429260.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v0429260.1 78914_g.1
(331 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC60040 homologue to UniRef100_Q0GPG0 Cluster: BZIP tra... 76 2e-13
>gnl|LJGI|TC60040 homologue to UniRef100_Q0GPG0 Cluster: BZIP transcription factor
bZIP122; n=1; Glycine max|Rep: BZIP transcription factor
bZIP122 - Glycine max (Soybean), partial (70%)
Length = 806
Score = 75.8 bits (38), Expect = 2e-13
Identities = 71/82 (86%)
Strand = Plus / Minus
Query: 133 gtgtgggtgtgggtacaagcgtgtgtatccttcaagagctcgtcgaagaaattgtccatg 192
|||||||| ||||| ||| |||| || ||||| | ||||||||||||||| ||||||||
Sbjct: 243 gtgtgggtatgggtgcaaccgtgcgtgtccttgagaagctcgtcgaagaaactgtccatg 184
Query: 193 gaactgcttctgggaatctcgc 214
|||| ||| |||||||||||||
Sbjct: 183 gaaccgctgctgggaatctcgc 162