Miyakogusa Predicted Gene

Lj3g3v0429260.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v0429260.1 78914_g.1
         (331 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC60040 homologue to UniRef100_Q0GPG0 Cluster: BZIP tra...    76   2e-13

>gnl|LJGI|TC60040 homologue to UniRef100_Q0GPG0 Cluster: BZIP transcription factor
           bZIP122; n=1; Glycine max|Rep: BZIP transcription factor
           bZIP122 - Glycine max (Soybean), partial (70%)
          Length = 806

 Score = 75.8 bits (38), Expect = 2e-13
 Identities = 71/82 (86%)
 Strand = Plus / Minus

                                                                       
Query: 133 gtgtgggtgtgggtacaagcgtgtgtatccttcaagagctcgtcgaagaaattgtccatg 192
           |||||||| ||||| ||| |||| || ||||| |  ||||||||||||||| ||||||||
Sbjct: 243 gtgtgggtatgggtgcaaccgtgcgtgtccttgagaagctcgtcgaagaaactgtccatg 184

                                 
Query: 193 gaactgcttctgggaatctcgc 214
           |||| ||| |||||||||||||
Sbjct: 183 gaaccgctgctgggaatctcgc 162