Miyakogusa Predicted Gene

Lj3g3v0423810.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v0423810.1 tr|G7LBH1|G7LBH1_MEDTR NBS-LRR resistance-like
protein OS=Medicago truncatula GN=MTR_8g105820 PE=4 S,29.81,0.0004,
,NODE_80989_length_907_cov_8.740904.path1.1
         (316 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC62701 similar to UniRef100_A3CYW8 Cluster: Protoheme ...   198   1e-50
gnl|LJGI|BP064614                                                      56   1e-07
gnl|LJGI|BP085074 similar to UniRef100_A6FCH2 Cluster: GGDEF dom...    50   8e-06

>gnl|LJGI|TC62701 similar to UniRef100_A3CYW8 Cluster: Protoheme IX
           farnesyltransferase precursor; n=2; Shewanella
           baltica|Rep: Protoheme IX farnesyltransferase precursor
           - Shewanella baltica (strain OS155 / ATCC BAA-1091),
           partial (7%)
          Length = 881

 Score =  198 bits (100), Expect = 1e-50
 Identities = 250/300 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtgtctcgttttgcaactgaaagatacaagatatggtccttttcaatgcagaataaca 60
           |||||| ||||||||||||  ||| ||||| ||| |||| ||||  ||||||| |||| |
Sbjct: 288 atgtgtttcgttttgcaacataaaaatacaggatctggttctttaaaatgcagcataata 347

                                                                       
Query: 61  tttaaatctgatggccgcacatacacccttccccaggaagcccagcttagaaactctttc 120
            |||||| ||||||  |||||| |||||||||||| ||||  ||||| ||| ||||||| 
Sbjct: 348 gttaaatttgatgggtgcacattcacccttccccaagaagatcagctaagagactctttt 407

                                                                       
Query: 121 tctttcagtgctcaacaaatgggacagagagatcacacattcctatggaaatcttactta 180
           |||| |||||||  |||| ||||||||||||||||||||||||||||||||| |||||||
Sbjct: 408 tcttgcagtgctgcacaagtgggacagagagatcacacattcctatggaaatattactta 467

                                                                       
Query: 181 acgaagtcggtccacaaagggatctttcatgcctccagcttcacttttaggaacacatat 240
           ||| | || ||| || ||||||| ||||| ||||||||||||||||||| || | |   |
Sbjct: 468 acggactctgtcgacgaagggatttttcacgcctccagcttcacttttaagatccctatt 527

                                                                       
Query: 241 aggctgtattctgaaacaagttatttggtgaaagagtgtggaatatgccccctttatacc 300
             |   |||  |||| ||||||||  ||||||||||||||||||||||||||||||||||
Sbjct: 528 ccgagctatcatgaaccaagttatgaggtgaaagagtgtggaatatgccccctttatacc 587


>gnl|LJGI|BP064614 
          Length = 473

 Score = 56.0 bits (28), Expect = 1e-07
 Identities = 53/60 (88%), Gaps = 1/60 (1%)
 Strand = Plus / Minus

                                                                       
Query: 257 caagttatttggtgaaagagtgtggaatatgccccctttataccaaaagaaaaatatgat 316
           |||||| ||||||||||||||| ||||||| ||| |||||||  |||||||||| |||||
Sbjct: 368 caagttctttggtgaaagagtgcggaatataccctctttata-gaaaagaaaaagatgat 310


>gnl|LJGI|BP085074 similar to UniRef100_A6FCH2 Cluster: GGDEF domain protein; n=1;
           Moritella sp. PE36|Rep: GGDEF domain protein - Moritella
           sp. PE36, partial (5%)
          Length = 440

 Score = 50.1 bits (25), Expect = 8e-06
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 271 aaagagtgtggaatatgccccctttataccaaa 303
           |||||||||||||||||||| |||||| |||||
Sbjct: 381 aaagagtgtggaatatgccctctttatgccaaa 349