Miyakogusa Predicted Gene

Lj3g3v0419510.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v0419510.1 Non Chatacterized Hit- tr|I3SPD2|I3SPD2_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2 SV=1,67.47,0,WRKY
DNA-binding domain,DNA-binding WRKY; DNA binding domain,DNA-binding
WRKY; WRKY,DNA-binding WRKY,CUFF.40650.1
         (504 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO011819 similar to UniRef100_A7P4P4 Cluster: Chromosom...   172   1e-42
gnl|LJGI|GO009948 similar to UniRef100_A7P4P4 Cluster: Chromosom...   165   3e-40
gnl|LJGI|TC69522 similar to UniRef100_A7P4P4 Cluster: Chromosome...   105   3e-22
gnl|LJGI|TC59051 similar to UniRef100_Q2PJS3 Cluster: WRKY21; n=...    72   4e-12

>gnl|LJGI|GO011819 similar to UniRef100_A7P4P4 Cluster: Chromosome chr4 scaffold_6,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr4 scaffold_6, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (54%)
          Length = 657

 Score =  172 bits (87), Expect = 1e-42
 Identities = 189/223 (84%)
 Strand = Plus / Plus

                                                                       
Query: 279 agtttcattcaaaaccaagtcagaggttgaaatactggatgatgggttcaagtggagaaa 338
           |||| |||||||||| |||||||| |||||||||||  ||||||||||||| ||||| ||
Sbjct: 286 agttgcattcaaaacaaagtcagaagttgaaatactaaatgatgggttcaaatggaggaa 345

                                                                       
Query: 339 gtatggaaagaagatggtgaaaaacagtcccaatccaaggaactactacaggtgttcagt 398
           |||||| ||||| |||||||| ||||| |||||||||||||| ||||| ||||| |||||
Sbjct: 346 gtatggcaagaaaatggtgaagaacagccccaatccaaggaattactataggtgctcagt 405

                                                                       
Query: 399 ggagggatgtcgtgtgaagaaaagagtagagagagatagggatgatccaagttatgtaat 458
            || ||||||| ||| || || || || ||||||||||  |||||| |||| ||||||||
Sbjct: 406 agaaggatgtcctgttaaaaagagggttgagagagataacgatgattcaagatatgtaat 465

                                                      
Query: 459 aacaacctatgaaggcacccatactcacccaagttcttactag 501
            |||||||| |||||||  || ||||| || ||||||| ||||
Sbjct: 466 cacaacctacgaaggcatgcacactcatccgagttcttgctag 508


>gnl|LJGI|GO009948 similar to UniRef100_A7P4P4 Cluster: Chromosome chr4 scaffold_6,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr4 scaffold_6, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (46%)
          Length = 625

 Score =  165 bits (83), Expect = 3e-40
 Identities = 188/223 (84%)
 Strand = Plus / Plus

                                                                       
Query: 279 agtttcattcaaaaccaagtcagaggttgaaatactggatgatgggttcaagtggagaaa 338
           |||| |||||||||| |||||||| |||||||||||  ||||||||||||| ||||| ||
Sbjct: 141 agttgcattcaaaacaaagtcagaagttgaaatactaaatgatgggttcaaatggaggaa 200

                                                                       
Query: 339 gtatggaaagaagatggtgaaaaacagtcccaatccaaggaactactacaggtgttcagt 398
           |||||| ||||| |||||||| ||||| |||||||||||||| | ||| ||||| |||||
Sbjct: 201 gtatggcaagaaaatggtgaagaacagccccaatccaaggaattgctataggtgctcagt 260

                                                                       
Query: 399 ggagggatgtcgtgtgaagaaaagagtagagagagatagggatgatccaagttatgtaat 458
            || ||||||| ||| || || || || ||||||||||  |||||| |||| ||||||||
Sbjct: 261 agaaggatgtcctgttaaaaagagggttgagagagataacgatgattcaagatatgtaat 320

                                                      
Query: 459 aacaacctatgaaggcacccatactcacccaagttcttactag 501
            |||||||| |||||||  || ||||| || ||||||| ||||
Sbjct: 321 cacaacctacgaaggcatgcacactcatccgagttcttgctag 363


>gnl|LJGI|TC69522 similar to UniRef100_A7P4P4 Cluster: Chromosome chr4 scaffold_6,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr4 scaffold_6, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (13%)
          Length = 684

 Score =  105 bits (53), Expect = 3e-22
 Identities = 62/65 (95%)
 Strand = Plus / Plus

                                                                       
Query: 312 actggatgatgggttcaagtggagaaagtatggaaagaagatggtgaaaaacagtcccaa 371
           ||||||||||||||||||||||||||||||||||||||||||||||||||| | || |||
Sbjct: 507 actggatgatgggttcaagtggagaaagtatggaaagaagatggtgaaaaaaaatctcaa 566

                
Query: 372 tccaa 376
           |||||
Sbjct: 567 tccaa 571


>gnl|LJGI|TC59051 similar to UniRef100_Q2PJS3 Cluster: WRKY21; n=1; Glycine max|Rep:
           WRKY21 - Glycine max (Soybean), partial (62%)
          Length = 833

 Score = 71.9 bits (36), Expect = 4e-12
 Identities = 102/124 (82%)
 Strand = Plus / Plus

                                                                       
Query: 314 tggatgatgggttcaagtggagaaagtatggaaagaagatggtgaaaaacagtcccaatc 373
           |||||||||| | ||| ||||| |||||||| ||||||   || || |||| ||||||||
Sbjct: 364 tggatgatggatacaaatggaggaagtatgggaagaagtcagtcaagaacaatcccaatc 423

                                                                       
Query: 374 caaggaactactacaggtgttcagtggagggatgtcgtgtgaagaaaagagtagagagag 433
             ||||||||||||| ||||||||  ||||||||  |||| |||||||| || || ||||
Sbjct: 424 tcaggaactactacaagtgttcaggtgagggatgcagtgtaaagaaaagggtggaaagag 483

               
Query: 434 atag 437
           ||||
Sbjct: 484 atag 487