Miyakogusa Predicted Gene

Lj3g3v0370440.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v0370440.1 Non Chatacterized Hit- tr|A5C639|A5C639_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,49.49,1e-17,DUF936,Protein of unknown function DUF936, plant;
FAMILY NOT NAMED,NULL,CUFF.40844.1
         (597 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC81786 similar to UniRef100_A9U357 Cluster: Predicted ...    64   1e-09

>gnl|LJGI|TC81786 similar to UniRef100_A9U357 Cluster: Predicted protein; n=1;
           Physcomitrella patens subsp. patens|Rep: Predicted
           protein - Physcomitrella patens subsp. patens, partial
           (5%)
          Length = 721

 Score = 63.9 bits (32), Expect = 1e-09
 Identities = 136/170 (80%), Gaps = 3/170 (1%)
 Strand = Plus / Plus

                                                                       
Query: 431 atgaggtggttaatttggctgaaatgttgcaattacagtcccgagactggttcgtaggat 490
           |||| ||||| ||||||||||| ||| ||||||| |  || |||||||||||  |   ||
Sbjct: 1   atgaagtggtcaatttggctgacatgctgcaattgcgatcgcgagactggtttttgttat 60

                                                                       
Query: 491 tcgttgagaggttcttggacattgacggggacaatacc---ttgtcagataatggccaaa 547
           | |||||||  ||| |||||| ||| ||||| |||||    |||||| | ||||||||||
Sbjct: 61  ttgttgagaaattcctggacactgatggggataatactggtttgtcaaacaatggccaaa 120

                                                             
Query: 548 ttgcaggtatgctctctcagctgaagagtgtaaatgattggttagatgag 597
           | ||||| ||||||  ||| || || ||||||||||||||||| ||||||
Sbjct: 121 tagcaggcatgctcagtcaactaaaaagtgtaaatgattggttggatgag 170