Miyakogusa Predicted Gene
- Lj3g3v0324630.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v0324630.1 tr|G7KYM9|G7KYM9_MEDTR Lipoxygenase OS=Medicago
truncatula GN=MTR_7g113410 PE=3
SV=1,51.61,0.00000000001,LIPOXYGENASE,NULL; LIPOXYGENASE,Lipoxygenase;
LIPOXYGENASE_3,Lipoxygenase, C-terminal; Lipoxigenase,,CUFF.40540.1
(390 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC75730 similar to UniRef100_Q9M3Z5 Cluster: Lipoxygena... 159 2e-38
gnl|LJGI|BP054115 similar to UniRef100_Q9M3Z5 Cluster: Lipoxygen... 129 1e-29
gnl|LJGI|TC57788 similar to UniRef100_O24470 Cluster: Lipoxygena... 127 5e-29
gnl|LJGI|TC76313 similar to UniRef100_Q9M3Z5 Cluster: Lipoxygena... 125 2e-28
gnl|LJGI|TC75743 similar to UniRef100_Q9M3Z5 Cluster: Lipoxygena... 113 8e-25
gnl|LJGI|TC60253 similar to UniRef100_P09918 Cluster: Seed lipox... 111 3e-24
gnl|LJGI|TC68156 similar to UniRef100_O04919 Cluster: Lipoxygena... 105 2e-22
gnl|LJGI|BP065732 similar to UniRef100_O04919 Cluster: Lipoxygen... 74 7e-13
gnl|LJGI|GO025531 similar to UniRef100_Q9M3Z5 Cluster: Lipoxygen... 66 2e-10
gnl|LJGI|TC79832 similar to UniRef100_O24470 Cluster: Lipoxygena... 66 2e-10
>gnl|LJGI|TC75730 similar to UniRef100_Q9M3Z5 Cluster: Lipoxygenase; n=1; Cicer
arietinum|Rep: Lipoxygenase - Cicer arietinum (Chickpea)
(Garbanzo), partial (93%)
Length = 1640
Score = 159 bits (80), Expect = 2e-38
Identities = 164/192 (85%)
Strand = Plus / Plus
Query: 7 agaagattgcttcctgagaaaggaactgcagaatatgatgaaatggtgaagagtcatcaa 66
||||||||| | || || ||||||||| ||||||||||||| ||||| || | || ||||
Sbjct: 1129 agaagattgatcccagaaaaaggaactccagaatatgatgagatggttaaaaatcctcaa 1188
Query: 67 aaggcttatttgagaacaatcacaccaaagcttcaggctctcattgacctttcagtgata 126
|||||||| | ||||| |||||||||||| |||||||| |||||||||| ||||||
Sbjct: 1189 aaggcttacctcagaaccatcacaccaaagtaccaggctcttgttgacctttctgtgata 1248
Query: 127 gaaatcttgtccaggcatgcttctgatgaggtctaccttggagaaagggagaatccacat 186
|| || ||||| |||||||||||||||||| |||||||||| || |||||||||||| ||
Sbjct: 1249 gagatattgtctaggcatgcttctgatgagatctaccttggggagagggagaatccaaat 1308
Query: 187 tggacctctgat 198
||||| ||||||
Sbjct: 1309 tggacatctgat 1320
>gnl|LJGI|BP054115 similar to UniRef100_Q9M3Z5 Cluster: Lipoxygenase; n=1; Cicer
arietinum|Rep: Lipoxygenase - Cicer arietinum (Chickpea)
(Garbanzo), partial (24%)
Length = 556
Score = 129 bits (65), Expect = 1e-29
Identities = 190/232 (81%)
Strand = Plus / Minus
Query: 27 aggaactgcagaatatgatgaaatggtgaagagtcatcaaaaggcttatttgagaacaat 86
||||||| |||| |||||||| |||||||| |||| |||||||||||| || ||||| ||
Sbjct: 479 aggaactccagagtatgatgagatggtgaaaagtcctcaaaaggcttacttaagaaccat 420
Query: 87 cacaccaaagcttcaggctctcattgacctttcagtgatagaaatcttgtccaggcatgc 146
|| |||||| | || |||| ||||| ||| | |||||||| || ||||| ||||||||
Sbjct: 419 tacgccaaagtatgagactcttattgatcttactgtgatagagatattgtctaggcatgc 360
Query: 147 ttctgatgaggtctaccttggagaaagggagaatccacattggacctctgatgaaagagc 206
|||||||||| |||||||||| || |||||||||||| | ||||| |||||| || ||
Sbjct: 359 ttctgatgagatctaccttggggagagggagaatccagaatggacatctgatacaaaggc 300
Query: 207 tttacaagaatttgagaagtttggaagtaagctggcagaaattgaggcaaaa 258
||||| || | ||||||||||| ||||||||||| ||||| ||||||
Sbjct: 299 naaacaagccttccaaaagtttggaagcaagctggcagagattgaagcaaaa 248
>gnl|LJGI|TC57788 similar to UniRef100_O24470 Cluster: Lipoxygenase; n=1; Pisum
sativum|Rep: Lipoxygenase - Pisum sativum (Garden pea),
partial (96%)
Length = 2928
Score = 127 bits (64), Expect = 5e-29
Identities = 145/172 (84%)
Strand = Plus / Plus
Query: 27 aggaactgcagaatatgatgaaatggtgaagagtcatcaaaaggcttatttgagaacaat 86
||||||| |||| |||||||| |||||||| |||| |||||||||||| || ||||| ||
Sbjct: 2290 aggaactccagagtatgatgagatggtgaaaagtcctcaaaaggcttacttaagaaccat 2349
Query: 87 cacaccaaagcttcaggctctcattgacctttcagtgatagaaatcttgtccaggcatgc 146
|| |||||| | || |||| ||||| ||| | |||||||| || ||||| ||||||||
Sbjct: 2350 tacgccaaagtatgagactcttattgatcttactgtgatagagatattgtctaggcatgc 2409
Query: 147 ttctgatgaggtctaccttggagaaagggagaatccacattggacctctgat 198
|||||||||| |||||||||| || |||||||||||| | ||||| ||||||
Sbjct: 2410 ttctgatgagatctaccttggggagagggagaatccagaatggacatctgat 2461
>gnl|LJGI|TC76313 similar to UniRef100_Q9M3Z5 Cluster: Lipoxygenase; n=1; Cicer
arietinum|Rep: Lipoxygenase - Cicer arietinum (Chickpea)
(Garbanzo), partial (62%)
Length = 1226
Score = 125 bits (63), Expect = 2e-28
Identities = 144/171 (84%)
Strand = Plus / Plus
Query: 28 ggaactgcagaatatgatgaaatggtgaagagtcatcaaaaggcttatttgagaacaatc 87
|||||| | ||||||||||| |||||||| | || ||| |||||||| |||||||| |||
Sbjct: 723 ggaactccggaatatgatgagatggtgaaaaatcctcagaaggcttacttgagaaccatc 782
Query: 88 acaccaaagcttcaggctctcattgacctttcagtgatagaaatcttgtccaggcatgct 147
||||| ||| ||| |||| |||| ||||| |||||||| || ||||| |||||||||
Sbjct: 783 acaccgaagtaccagactcttgttgatctttctgtgatagagatattgtctaggcatgct 842
Query: 148 tctgatgaggtctaccttggagaaagggagaatccacattggacctctgat 198
||||||||| |||| ||||| || |||||||||||| ||||||| ||||||
Sbjct: 843 tctgatgagatctatcttggggagagggagaatccaaattggacatctgat 893
>gnl|LJGI|TC75743 similar to UniRef100_Q9M3Z5 Cluster: Lipoxygenase; n=1; Cicer
arietinum|Rep: Lipoxygenase - Cicer arietinum (Chickpea)
(Garbanzo), partial (19%)
Length = 482
Score = 113 bits (57), Expect = 8e-25
Identities = 117/137 (85%)
Strand = Plus / Plus
Query: 115 ctttcagtgatagaaatcttgtccaggcatgcttctgatgaggtctaccttggagaaagg 174
||||| |||||||| || ||||| |||||||||||||||||||||||||||||| | |||
Sbjct: 29 ctttcggtgatagagatattgtctaggcatgcttctgatgaggtctaccttggacagagg 88
Query: 175 gagaatccacattggacctctgatgaaagagctttacaagaatttgagaagtttggaagt 234
|| |||||| ||||||| |||||| ||| || ||||||| || |||||||||||||
Sbjct: 89 gacaatccaaattggacatctgatacaagggcattacaagccttccagaagtttggaagc 148
Query: 235 aagctggcagaaattga 251
|||||| |||||||||
Sbjct: 149 aagctgcaagaaattga 165
>gnl|LJGI|TC60253 similar to UniRef100_P09918 Cluster: Seed lipoxygenase-3; n=1;
Pisum sativum|Rep: Seed lipoxygenase-3 - Pisum sativum
(Garden pea), partial (27%)
Length = 861
Score = 111 bits (56), Expect = 3e-24
Identities = 146/176 (82%)
Strand = Plus / Plus
Query: 23 agaaaggaactgcagaatatgatgaaatggtgaagagtcatcaaaaggcttatttgagaa 82
||||||||||| | || |||||||| |||| |||| | ||| |||||||| |||| |
Sbjct: 350 agaaaggaactcctgagtatgatgagctggtcgagagccctcagaaggcttacttgaaga 409
Query: 83 caatcacaccaaagcttcaggctctcattgacctttcagtgatagaaatcttgtccaggc 142
||||||| |||||| ||||| | || ||||||||||| || |||||||||||||| || |
Sbjct: 410 caatcactccaaagtttcagacccttattgacctttctgttatagaaatcttgtcaagac 469
Query: 143 atgcttctgatgaggtctaccttggagaaagggagaatccacattggacctctgat 198
|||||||||||||| | |||||||| || || || |||||| ||||||| ||||||
Sbjct: 470 atgcttctgatgagttgtaccttggggagagagacaatccaaattggacatctgat 525
>gnl|LJGI|TC68156 similar to UniRef100_O04919 Cluster: Lipoxygenase; n=1; Vicia
faba|Rep: Lipoxygenase - Vicia faba (Broad bean),
partial (24%)
Length = 808
Score = 105 bits (53), Expect = 2e-22
Identities = 89/101 (88%)
Strand = Plus / Plus
Query: 67 aaggcttatttgagaacaatcacaccaaagcttcaggctctcattgacctttcagtgata 126
|||||||| ||||| ||||| |||||||||||||| |||||||||| |||||||| ||
Sbjct: 307 aaggcttacttgaggacaattacaccaaagcttcaaactctcattgatctttcagtcatt 366
Query: 127 gaaatcttgtccaggcatgcttctgatgaggtctaccttgg 167
||||| ||||| |||||||||||||||||| |||||||||
Sbjct: 367 gaaatattgtcaaggcatgcttctgatgagtactaccttgg 407
>gnl|LJGI|BP065732 similar to UniRef100_O04919 Cluster: Lipoxygenase; n=1; Vicia
faba|Rep: Lipoxygenase - Vicia faba (Broad bean),
partial (11%)
Length = 474
Score = 73.8 bits (37), Expect = 7e-13
Identities = 57/64 (89%)
Strand = Plus / Minus
Query: 104 ctctcattgacctttcagtgatagaaatcttgtccaggcatgcttctgatgaggtctacc 163
|||||||||| |||||||| || ||||| |||||||| ||||||||||||||| |||||
Sbjct: 473 ctctcattgatctttcagtcattgaaatattgtccagncatgcttctgatgagtactacc 414
Query: 164 ttgg 167
||||
Sbjct: 413 ttgg 410
>gnl|LJGI|GO025531 similar to UniRef100_Q9M3Z5 Cluster: Lipoxygenase; n=1; Cicer
arietinum|Rep: Lipoxygenase - Cicer arietinum (Chickpea)
(Garbanzo), partial (11%)
Length = 611
Score = 65.9 bits (33), Expect = 2e-10
Identities = 39/41 (95%)
Strand = Plus / Plus
Query: 346 gaagggttaacttttagaggaattcctaacagcatctctat 386
|||||||||||||| ||||||||||| ||||||||||||||
Sbjct: 423 gaagggttaactttcagaggaattcccaacagcatctctat 463
>gnl|LJGI|TC79832 similar to UniRef100_O24470 Cluster: Lipoxygenase; n=1; Pisum
sativum|Rep: Lipoxygenase - Pisum sativum (Garden pea),
partial (32%)
Length = 926
Score = 65.9 bits (33), Expect = 2e-10
Identities = 39/41 (95%)
Strand = Plus / Plus
Query: 346 gaagggttaacttttagaggaattcctaacagcatctctat 386
|||||||||||||| ||||||||||| ||||||||||||||
Sbjct: 827 gaagggttaactttcagaggaattcccaacagcatctctat 867
Score = 52.0 bits (26), Expect = 3e-06
Identities = 59/70 (84%)
Strand = Plus / Plus
Query: 27 aggaactgcagaatatgatgaaatggtgaagagtcatcaaaaggcttatttgagaacaat 86
||||||| |||| |||||||| |||| ||| |||| |||||||||||| || ||||| ||
Sbjct: 546 aggaactccagagtatgatgagatggggaaaagtcctcaaaaggcttacttaagaaccat 605
Query: 87 cacaccaaag 96
|| ||||||
Sbjct: 606 tacgccaaag 615