Miyakogusa Predicted Gene

Lj3g3v0324630.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v0324630.1 tr|G7KYM9|G7KYM9_MEDTR Lipoxygenase OS=Medicago
truncatula GN=MTR_7g113410 PE=3
SV=1,51.61,0.00000000001,LIPOXYGENASE,NULL; LIPOXYGENASE,Lipoxygenase;
LIPOXYGENASE_3,Lipoxygenase, C-terminal; Lipoxigenase,,CUFF.40540.1
         (390 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC75730 similar to UniRef100_Q9M3Z5 Cluster: Lipoxygena...   159   2e-38
gnl|LJGI|BP054115 similar to UniRef100_Q9M3Z5 Cluster: Lipoxygen...   129   1e-29
gnl|LJGI|TC57788 similar to UniRef100_O24470 Cluster: Lipoxygena...   127   5e-29
gnl|LJGI|TC76313 similar to UniRef100_Q9M3Z5 Cluster: Lipoxygena...   125   2e-28
gnl|LJGI|TC75743 similar to UniRef100_Q9M3Z5 Cluster: Lipoxygena...   113   8e-25
gnl|LJGI|TC60253 similar to UniRef100_P09918 Cluster: Seed lipox...   111   3e-24
gnl|LJGI|TC68156 similar to UniRef100_O04919 Cluster: Lipoxygena...   105   2e-22
gnl|LJGI|BP065732 similar to UniRef100_O04919 Cluster: Lipoxygen...    74   7e-13
gnl|LJGI|GO025531 similar to UniRef100_Q9M3Z5 Cluster: Lipoxygen...    66   2e-10
gnl|LJGI|TC79832 similar to UniRef100_O24470 Cluster: Lipoxygena...    66   2e-10

>gnl|LJGI|TC75730 similar to UniRef100_Q9M3Z5 Cluster: Lipoxygenase; n=1; Cicer
            arietinum|Rep: Lipoxygenase - Cicer arietinum (Chickpea)
            (Garbanzo), partial (93%)
          Length = 1640

 Score =  159 bits (80), Expect = 2e-38
 Identities = 164/192 (85%)
 Strand = Plus / Plus

                                                                        
Query: 7    agaagattgcttcctgagaaaggaactgcagaatatgatgaaatggtgaagagtcatcaa 66
            ||||||||| | || || ||||||||| ||||||||||||| ||||| || | || ||||
Sbjct: 1129 agaagattgatcccagaaaaaggaactccagaatatgatgagatggttaaaaatcctcaa 1188

                                                                        
Query: 67   aaggcttatttgagaacaatcacaccaaagcttcaggctctcattgacctttcagtgata 126
            ||||||||  | ||||| ||||||||||||   ||||||||  |||||||||| ||||||
Sbjct: 1189 aaggcttacctcagaaccatcacaccaaagtaccaggctcttgttgacctttctgtgata 1248

                                                                        
Query: 127  gaaatcttgtccaggcatgcttctgatgaggtctaccttggagaaagggagaatccacat 186
            || || ||||| |||||||||||||||||| |||||||||| || |||||||||||| ||
Sbjct: 1249 gagatattgtctaggcatgcttctgatgagatctaccttggggagagggagaatccaaat 1308

                        
Query: 187  tggacctctgat 198
            ||||| ||||||
Sbjct: 1309 tggacatctgat 1320


>gnl|LJGI|BP054115 similar to UniRef100_Q9M3Z5 Cluster: Lipoxygenase; n=1; Cicer
           arietinum|Rep: Lipoxygenase - Cicer arietinum (Chickpea)
           (Garbanzo), partial (24%)
          Length = 556

 Score =  129 bits (65), Expect = 1e-29
 Identities = 190/232 (81%)
 Strand = Plus / Minus

                                                                       
Query: 27  aggaactgcagaatatgatgaaatggtgaagagtcatcaaaaggcttatttgagaacaat 86
           ||||||| |||| |||||||| |||||||| |||| |||||||||||| || ||||| ||
Sbjct: 479 aggaactccagagtatgatgagatggtgaaaagtcctcaaaaggcttacttaagaaccat 420

                                                                       
Query: 87  cacaccaaagcttcaggctctcattgacctttcagtgatagaaatcttgtccaggcatgc 146
            || ||||||  | || |||| ||||| ||| | |||||||| || ||||| ||||||||
Sbjct: 419 tacgccaaagtatgagactcttattgatcttactgtgatagagatattgtctaggcatgc 360

                                                                       
Query: 147 ttctgatgaggtctaccttggagaaagggagaatccacattggacctctgatgaaagagc 206
           |||||||||| |||||||||| || |||||||||||| | ||||| ||||||  ||  ||
Sbjct: 359 ttctgatgagatctaccttggggagagggagaatccagaatggacatctgatacaaaggc 300

                                                               
Query: 207 tttacaagaatttgagaagtttggaagtaagctggcagaaattgaggcaaaa 258
              |||||  ||  | ||||||||||| ||||||||||| ||||| ||||||
Sbjct: 299 naaacaagccttccaaaagtttggaagcaagctggcagagattgaagcaaaa 248


>gnl|LJGI|TC57788 similar to UniRef100_O24470 Cluster: Lipoxygenase; n=1; Pisum
            sativum|Rep: Lipoxygenase - Pisum sativum (Garden pea),
            partial (96%)
          Length = 2928

 Score =  127 bits (64), Expect = 5e-29
 Identities = 145/172 (84%)
 Strand = Plus / Plus

                                                                        
Query: 27   aggaactgcagaatatgatgaaatggtgaagagtcatcaaaaggcttatttgagaacaat 86
            ||||||| |||| |||||||| |||||||| |||| |||||||||||| || ||||| ||
Sbjct: 2290 aggaactccagagtatgatgagatggtgaaaagtcctcaaaaggcttacttaagaaccat 2349

                                                                        
Query: 87   cacaccaaagcttcaggctctcattgacctttcagtgatagaaatcttgtccaggcatgc 146
             || ||||||  | || |||| ||||| ||| | |||||||| || ||||| ||||||||
Sbjct: 2350 tacgccaaagtatgagactcttattgatcttactgtgatagagatattgtctaggcatgc 2409

                                                                
Query: 147  ttctgatgaggtctaccttggagaaagggagaatccacattggacctctgat 198
            |||||||||| |||||||||| || |||||||||||| | ||||| ||||||
Sbjct: 2410 ttctgatgagatctaccttggggagagggagaatccagaatggacatctgat 2461


>gnl|LJGI|TC76313 similar to UniRef100_Q9M3Z5 Cluster: Lipoxygenase; n=1; Cicer
           arietinum|Rep: Lipoxygenase - Cicer arietinum (Chickpea)
           (Garbanzo), partial (62%)
          Length = 1226

 Score =  125 bits (63), Expect = 2e-28
 Identities = 144/171 (84%)
 Strand = Plus / Plus

                                                                       
Query: 28  ggaactgcagaatatgatgaaatggtgaagagtcatcaaaaggcttatttgagaacaatc 87
           |||||| | ||||||||||| |||||||| | || ||| |||||||| |||||||| |||
Sbjct: 723 ggaactccggaatatgatgagatggtgaaaaatcctcagaaggcttacttgagaaccatc 782

                                                                       
Query: 88  acaccaaagcttcaggctctcattgacctttcagtgatagaaatcttgtccaggcatgct 147
           ||||| |||   ||| ||||  |||| ||||| |||||||| || ||||| |||||||||
Sbjct: 783 acaccgaagtaccagactcttgttgatctttctgtgatagagatattgtctaggcatgct 842

                                                              
Query: 148 tctgatgaggtctaccttggagaaagggagaatccacattggacctctgat 198
           ||||||||| |||| ||||| || |||||||||||| ||||||| ||||||
Sbjct: 843 tctgatgagatctatcttggggagagggagaatccaaattggacatctgat 893


>gnl|LJGI|TC75743 similar to UniRef100_Q9M3Z5 Cluster: Lipoxygenase; n=1; Cicer
           arietinum|Rep: Lipoxygenase - Cicer arietinum (Chickpea)
           (Garbanzo), partial (19%)
          Length = 482

 Score =  113 bits (57), Expect = 8e-25
 Identities = 117/137 (85%)
 Strand = Plus / Plus

                                                                       
Query: 115 ctttcagtgatagaaatcttgtccaggcatgcttctgatgaggtctaccttggagaaagg 174
           ||||| |||||||| || ||||| |||||||||||||||||||||||||||||| | |||
Sbjct: 29  ctttcggtgatagagatattgtctaggcatgcttctgatgaggtctaccttggacagagg 88

                                                                       
Query: 175 gagaatccacattggacctctgatgaaagagctttacaagaatttgagaagtttggaagt 234
           || |||||| ||||||| ||||||  ||| || |||||||  ||  ||||||||||||| 
Sbjct: 89  gacaatccaaattggacatctgatacaagggcattacaagccttccagaagtttggaagc 148

                            
Query: 235 aagctggcagaaattga 251
           ||||||  |||||||||
Sbjct: 149 aagctgcaagaaattga 165


>gnl|LJGI|TC60253 similar to UniRef100_P09918 Cluster: Seed lipoxygenase-3; n=1;
           Pisum sativum|Rep: Seed lipoxygenase-3 - Pisum sativum
           (Garden pea), partial (27%)
          Length = 861

 Score =  111 bits (56), Expect = 3e-24
 Identities = 146/176 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  agaaaggaactgcagaatatgatgaaatggtgaagagtcatcaaaaggcttatttgagaa 82
           ||||||||||| | || ||||||||  ||||  |||| | ||| |||||||| ||||  |
Sbjct: 350 agaaaggaactcctgagtatgatgagctggtcgagagccctcagaaggcttacttgaaga 409

                                                                       
Query: 83  caatcacaccaaagcttcaggctctcattgacctttcagtgatagaaatcttgtccaggc 142
           ||||||| |||||| ||||| | || ||||||||||| || |||||||||||||| || |
Sbjct: 410 caatcactccaaagtttcagacccttattgacctttctgttatagaaatcttgtcaagac 469

                                                                   
Query: 143 atgcttctgatgaggtctaccttggagaaagggagaatccacattggacctctgat 198
           |||||||||||||| | |||||||| || || || |||||| ||||||| ||||||
Sbjct: 470 atgcttctgatgagttgtaccttggggagagagacaatccaaattggacatctgat 525


>gnl|LJGI|TC68156 similar to UniRef100_O04919 Cluster: Lipoxygenase; n=1; Vicia
           faba|Rep: Lipoxygenase - Vicia faba (Broad bean),
           partial (24%)
          Length = 808

 Score =  105 bits (53), Expect = 2e-22
 Identities = 89/101 (88%)
 Strand = Plus / Plus

                                                                       
Query: 67  aaggcttatttgagaacaatcacaccaaagcttcaggctctcattgacctttcagtgata 126
           |||||||| ||||| ||||| ||||||||||||||  |||||||||| |||||||| || 
Sbjct: 307 aaggcttacttgaggacaattacaccaaagcttcaaactctcattgatctttcagtcatt 366

                                                    
Query: 127 gaaatcttgtccaggcatgcttctgatgaggtctaccttgg 167
           ||||| ||||| ||||||||||||||||||  |||||||||
Sbjct: 367 gaaatattgtcaaggcatgcttctgatgagtactaccttgg 407


>gnl|LJGI|BP065732 similar to UniRef100_O04919 Cluster: Lipoxygenase; n=1; Vicia
           faba|Rep: Lipoxygenase - Vicia faba (Broad bean),
           partial (11%)
          Length = 474

 Score = 73.8 bits (37), Expect = 7e-13
 Identities = 57/64 (89%)
 Strand = Plus / Minus

                                                                       
Query: 104 ctctcattgacctttcagtgatagaaatcttgtccaggcatgcttctgatgaggtctacc 163
           |||||||||| |||||||| || ||||| |||||||| |||||||||||||||  |||||
Sbjct: 473 ctctcattgatctttcagtcattgaaatattgtccagncatgcttctgatgagtactacc 414

               
Query: 164 ttgg 167
           ||||
Sbjct: 413 ttgg 410


>gnl|LJGI|GO025531 similar to UniRef100_Q9M3Z5 Cluster: Lipoxygenase; n=1; Cicer
           arietinum|Rep: Lipoxygenase - Cicer arietinum (Chickpea)
           (Garbanzo), partial (11%)
          Length = 611

 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 346 gaagggttaacttttagaggaattcctaacagcatctctat 386
           |||||||||||||| ||||||||||| ||||||||||||||
Sbjct: 423 gaagggttaactttcagaggaattcccaacagcatctctat 463


>gnl|LJGI|TC79832 similar to UniRef100_O24470 Cluster: Lipoxygenase; n=1; Pisum
           sativum|Rep: Lipoxygenase - Pisum sativum (Garden pea),
           partial (32%)
          Length = 926

 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 346 gaagggttaacttttagaggaattcctaacagcatctctat 386
           |||||||||||||| ||||||||||| ||||||||||||||
Sbjct: 827 gaagggttaactttcagaggaattcccaacagcatctctat 867



 Score = 52.0 bits (26), Expect = 3e-06
 Identities = 59/70 (84%)
 Strand = Plus / Plus

                                                                       
Query: 27  aggaactgcagaatatgatgaaatggtgaagagtcatcaaaaggcttatttgagaacaat 86
           ||||||| |||| |||||||| |||| ||| |||| |||||||||||| || ||||| ||
Sbjct: 546 aggaactccagagtatgatgagatggggaaaagtcctcaaaaggcttacttaagaaccat 605

                     
Query: 87  cacaccaaag 96
            || ||||||
Sbjct: 606 tacgccaaag 615