Miyakogusa Predicted Gene

Lj3g3v0323300.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v0323300.1 tr|Q2HVE0|Q2HVE0_MEDTR Leucine-rich repeat;
Leucine-rich OS=Medicago truncatula
GN=MtrDRAFT_AC148918,87.68,0,DISEASE RESISTANCE PROTEIN (TIR-NBS-LRR
CLASS), PUTATIVE,NULL; LEUCINE-RICH REPEAT-CONTAINING
PROTEI,CUFF.40512.1
         (1047 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC67617 weakly similar to UniRef100_A7PPX7 Cluster: Chr...    58   1e-07
gnl|LJGI|FS333816 weakly similar to UniRef100_A2Q1X9 Cluster: TI...    56   5e-07
gnl|LJGI|DC593443 similar to UniRef100_Q9M5V7 Cluster: Disease r...    54   2e-06
gnl|LJGI|DC600092 weakly similar to UniRef100_Q2HVE0 Cluster: Le...    52   7e-06

>gnl|LJGI|TC67617 weakly similar to UniRef100_A7PPX7 Cluster: Chromosome chr18
           scaffold_24, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr18 scaffold_24, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (6%)
          Length = 633

 Score = 58.0 bits (29), Expect = 1e-07
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 101 ttggaatttggggcatggggggaattggtaagacaactattgcag 145
           ||||||||||||| |||||||| ||||| |||||||| |||||||
Sbjct: 393 ttggaatttggggtatggggggcattggcaagacaaccattgcag 437


>gnl|LJGI|FS333816 weakly similar to UniRef100_A2Q1X9 Cluster: TIR; n=1; Medicago
           truncatula|Rep: TIR - Medicago truncatula (Barrel
           medic), partial (13%)
          Length = 582

 Score = 56.0 bits (28), Expect = 5e-07
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 928 atgcatgacttgatacaagaaatgggttgggagattgttc 967
           |||||||||||| ||||||||||||| ||||| |||||||
Sbjct: 195 atgcatgacttgttacaagaaatgggatgggaaattgttc 234



 Score = 52.0 bits (26), Expect = 7e-06
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 760 gagaaaaacatctttctatacattgcatgttttttgaaagga 801
           |||||| |||| |||||| |||||||||||||||| ||||||
Sbjct: 36  gagaaagacatatttctagacattgcatgttttttcaaagga 77


>gnl|LJGI|DC593443 similar to UniRef100_Q9M5V7 Cluster: Disease resistance-like
           protein; n=1; Glycine max|Rep: Disease resistance-like
           protein - Glycine max (Soybean), partial (54%)
          Length = 564

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 96/119 (80%)
 Strand = Plus / Plus

                                                                       
Query: 340 aaggttcttcttgttcttgatgatatcagtgattcagagcacctagaaattttagttgga 399
           ||||||||| |||||||||||||| | | |||| |||| ||  |||||| | || |||||
Sbjct: 219 aaggttcttattgttcttgatgatgtgaatgatacagatcaggtagaaaatatatttgga 278

                                                                      
Query: 400 gcacttgattggtttggatctggtagcagaattattgtaacaactagagataagcaagt 458
            |  |||||||| ||   || ||||| ||||| ||  ||||||||||||||||||||||
Sbjct: 279 acggttgattggcttcactcaggtagtagaataataataacaactagagataagcaagt 337


>gnl|LJGI|DC600092 weakly similar to UniRef100_Q2HVE0 Cluster: Leucine-rich repeat;
           Leucine-rich; n=1; Medicago truncatula|Rep: Leucine-rich
           repeat; Leucine-rich - Medicago truncatula (Barrel
           medic), partial (13%)
          Length = 498

 Score = 52.0 bits (26), Expect = 7e-06
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 928 atgcatgacttgatacaagaaatggg 953
           ||||||||||||||||||||||||||
Sbjct: 24  atgcatgacttgatacaagaaatggg 49