Miyakogusa Predicted Gene

Lj3g3v0306950.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v0306950.1 Non Chatacterized Hit- tr|I3SZR7|I3SZR7_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2
SV=1,97.37,0.00000000000008,no description,Coproporphyrinogen III
oxidase, aerobic; Coprogen_oxidas,Coproporphyrinogen III
oxida,NODE_64709_length_75_cov_83.360001.path2.1
         (114 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC67565 homologue to UniRef100_P35055 Cluster: Copropor...   202   3e-52
gnl|LJGI|TC66607 homologue to UniRef100_P35055 Cluster: Copropor...   202   3e-52
gnl|LJGI|BP061811 similar to UniRef100_P35055 Cluster: Coproporp...    78   1e-14

>gnl|LJGI|TC67565 homologue to UniRef100_P35055 Cluster: Coproporphyrinogen III
           oxidase, chloroplast precursor; n=1; Glycine max|Rep:
           Coproporphyrinogen III oxidase, chloroplast precursor -
           Glycine max (Soybean), partial (51%)
          Length = 892

 Score =  202 bits (102), Expect = 3e-52
 Identities = 111/114 (97%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcttctttcctttgctactgaatgtgcaaattctgttattcctgcttatatacctatc 60
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| 
Sbjct: 281 atgcttctttcctttgctactgaatgtgcaaattctgttgttccttcttatatacctatt 340

                                                                 
Query: 61  atagagaaaaggaaggatacacccttcacagatcatcagaaagcatggcagcaa 114
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 341 atagagaaaaggaaggatacacccttcacagatcatcagaaagcatggcagcaa 394


>gnl|LJGI|TC66607 homologue to UniRef100_P35055 Cluster: Coproporphyrinogen III
            oxidase, chloroplast precursor; n=1; Glycine max|Rep:
            Coproporphyrinogen III oxidase, chloroplast precursor -
            Glycine max (Soybean), partial (88%)
          Length = 1667

 Score =  202 bits (102), Expect = 3e-52
 Identities = 111/114 (97%)
 Strand = Plus / Plus

                                                                        
Query: 1    atgcttctttcctttgctactgaatgtgcaaattctgttattcctgcttatatacctatc 60
            ||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| 
Sbjct: 956  atgcttctttcctttgctactgaatgtgcaaattctgttgttccttcttatatacctatt 1015

                                                                  
Query: 61   atagagaaaaggaaggatacacccttcacagatcatcagaaagcatggcagcaa 114
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1016 atagagaaaaggaaggatacacccttcacagatcatcagaaagcatggcagcaa 1069


>gnl|LJGI|BP061811 similar to UniRef100_P35055 Cluster: Coproporphyrinogen III oxidase
            chloroplast precursor; n=1; Glycine max|Rep:, partial
           (4%)
          Length = 477

 Score = 77.8 bits (39), Expect = 1e-14
 Identities = 39/39 (100%)
 Strand = Plus / Minus

                                                  
Query: 74  aggatacacccttcacagatcatcagaaagcatggcagc 112
           |||||||||||||||||||||||||||||||||||||||
Sbjct: 477 aggatacacccttcacagatcatcagaaagcatggcagc 439