Miyakogusa Predicted Gene

Lj3g3v0105880.2

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v0105880.2 tr|G7KTG9|G7KTG9_MEDTR Kinesin-like polypeptide
OS=Medicago truncatula GN=MTR_7g091290 PE=3 SV=1,73.37,0,no
description,Calponin homology domain; no description,Kinesin, motor
domain; Calponin homology dom,CUFF.40287.2
         (2970 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP053973                                                      58   3e-07
gnl|LJGI|TC67895 similar to UniRef100_Q7Y1U0 Cluster: Kinesin-li...    58   3e-07

>gnl|LJGI|BP053973 
          Length = 481

 Score = 58.0 bits (29), Expect = 3e-07
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 2930 taagaaggcaatctctaacagggattccaggacaaaact 2968
            ||||||| |||||||||||||||||| |||||| |||||
Sbjct: 481  taagaagncaatctctaacagggattncaggaccaaact 443


>gnl|LJGI|TC67895 similar to UniRef100_Q7Y1U0 Cluster: Kinesin-like calmodulin binding
            protein; n=1; Gossypium hirsutum|Rep: Kinesin-like
            calmodulin binding protein - Gossypium hirsutum (Upland
            cotton) (Gossypium mexicanum), partial (11%)
          Length = 599

 Score = 58.0 bits (29), Expect = 3e-07
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                         
Query: 1368 taatgtgtgcatttttgcttatggtcaaactggatctgggaagac 1412
            |||||| ||||| |||||||||||||||||||| ||||| |||||
Sbjct: 109  taatgtttgcatatttgcttatggtcaaactggctctggaaagac 153