Miyakogusa Predicted Gene

Lj3g3v0015490.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v0015490.1 Non Chatacterized Hit- tr|I1M5Y0|I1M5Y0_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.43985
PE,96.39,0,ATPase_P-type: HAD ATPase, P-type, family IC,ATPase,
P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter; H,CUFF.40201.1
         (585 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC80207 homologue to UniRef100_Q75N97 Cluster: Plasma m...   153   1e-36
gnl|LJGI|AU088926 similar to UniRef100_A7QRZ8 Cluster: Chromosom...   115   3e-25
gnl|LJGI|TC78704 homologue to UniRef100_Q7Y066 Cluster: Plasma m...    84   1e-15
gnl|LJGI|TC78495 homologue to UniRef100_Q4VCL9 Cluster: Plasma m...    72   4e-12

>gnl|LJGI|TC80207 homologue to UniRef100_Q75N97 Cluster: Plasma membrane H+-ATPase;
           n=1; Daucus carota|Rep: Plasma membrane H+-ATPase -
           Daucus carota (Carrot), partial (24%)
          Length = 718

 Score =  153 bits (77), Expect = 1e-36
 Identities = 351/441 (79%), Gaps = 1/441 (0%)
 Strand = Plus / Plus

                                                                       
Query: 121 gaacataaatatgagattgttaagaggcttcaggacaggaagcacatatgtgggatgact 180
           ||||| |||||||| || ||||||||||| || |||||||||||||||||||| ||||| 
Sbjct: 1   gaacacaaatatgaaatcgttaagaggctgcaagacaggaagcacatatgtggaatgaca 60

                                                                       
Query: 181 ggggatggtgtcaacgatgctccagccttgaaaagagcagatattggaattgcagtggct 240
           || ||||||||||||||||| || || || || |||||||||||||||||||| || || 
Sbjct: 61  ggtgatggtgtcaacgatgcccctgcattaaagagagcagatattggaattgctgttgca 120

                                                                       
Query: 241 gatgcaaccgatgcagcgcgaggtgcatctgatatagtcctcacggagcctggtttgagt 300
           || || || || || ||  || |||| ||||| || |||||||| || |||||  |||||
Sbjct: 121 gacgctacagacgctgctagaagtgcttctgacattgtcctcactgaacctgggctgagt 180

                                                                       
Query: 301 gtcattgtgagcgcagtgttgacaagcagagccatctttcagagaatgaagaactacacc 360
           |||||| | || |||||| | || ||||| || || || || || ||||| |||||||| 
Sbjct: 181 gtcattattagtgcagtgctcaccagcagggcgattttccaaaggatgaaaaactacacg 240

                                                                       
Query: 361 atatatgctgtttccataacaatccgaatcgtgctaggctttatgctccttgcactcatc 420
           || |||||||| || || || || || || ||| | || || ||| |  ||||| | || 
Sbjct: 241 atctatgctgtgtcaatcaccattcgtatagtgttcggtttcatgtttattgcattgatt 300

                                                                       
Query: 421 tggaag-tttgatttctcaccttttatggttctgatcattgccatactaaatgacgggac 479
           |||||| ||||||||  |||| || |||||  |||| |||||||||||||| || || ||
Sbjct: 301 tggaagttttgattttgcacccttcatggtattgataattgccatactaaacgatggtac 360

                                                                       
Query: 480 gatcatgacaatttccaaggatagggtgaagccatctcctcttccggattcatggaagct 539
            || |||||||| ||||||||| | ||||| ||||||||  | || |||   ||||||||
Sbjct: 361 cattatgacaatatccaaggatcgagtgaaaccatctccaatgcccgatagctggaagct 420

                                
Query: 540 gaatgagatctttgccaccgg 560
           ||| ||||| ||||| |||||
Sbjct: 421 gaaggagatatttgcaaccgg 441


>gnl|LJGI|AU088926 similar to UniRef100_A7QRZ8 Cluster: Chromosome undetermined
           scaffold_155, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome undetermined scaffold_155,
           whole genome shotgun sequence - Vitis vinifera (Grape),
           partial (17%)
          Length = 487

 Score =  115 bits (58), Expect = 3e-25
 Identities = 204/254 (80%), Gaps = 1/254 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggaagtaacatgtacccttcatcctccctccttggtgagcacaaggatgcgtctatt 60
           |||||||  |||||||  ||||||||||| || |||||| |   |||||||||  |||||
Sbjct: 161 atgggaaccaacatgtntccttcatcctctcttcttggtcaaagcaaggatgccgctatt 220

                                                                       
Query: 61  gctgctcttccaattgatgagcttattgagaaggctgatggctttgctggtgttttccct 120
           ||  || | || |||||||| || ||||||||||||||||| ||||| || || ||||||
Sbjct: 221 gcatctatcccnattgatgaactcattgagaaggctgatggatttgcaggagtcttccct 280

                                                                       
Query: 121 gaacataaatatgagattgttaagaggcttcaggacaggaagcacatatgtgggatgact 180
           ||||| || | ||||||||| || ||| | || || |  |||||||| ||||| ||||| 
Sbjct: 281 gaacacaagtntgagattgtgaanaggttgcangatacaaagcacatttgtggaatgacc 340

                                                                       
Query: 181 ggggatggtgtcaacgatgctccagccttgaaaagagcagatattggaattgcagtggct 240
           ||  ||||||| ||||| || || || ||||| | |||| | ||||| ||||||||||||
Sbjct: 341 gganatggtgtgaacgacgcacccgcattgaana-agcanacattggtattgcagtggct 399

                         
Query: 241 gatgcaaccgatgc 254
           |||||||| |||||
Sbjct: 400 gatgcaactgatgc 413


>gnl|LJGI|TC78704 homologue to UniRef100_Q7Y066 Cluster: Plasma membrane H+-ATPase;
           n=2; Sesbania rostrata|Rep: Plasma membrane H+-ATPase -
           Sesbania rostrata, partial (18%)
          Length = 512

 Score = 83.8 bits (42), Expect = 1e-15
 Identities = 93/110 (84%)
 Strand = Plus / Plus

                                                                       
Query: 415 ctcatctggaagtttgatttctcaccttttatggttctgatcattgccatactaaatgac 474
           ||||| ||||||||||| ||  ||||||||||||| ||||| |||||||| |||||||| 
Sbjct: 70  ctcatatggaagtttgactttccaccttttatggtgctgattattgccatcctaaatgat 129

                                                             
Query: 475 gggacgatcatgacaatttccaaggatagggtgaagccatctcctcttcc 524
           || || || |||||||| || || |||||||| || ||||| ||||||||
Sbjct: 130 ggtactattatgacaatctcaaaagatagggtaaaaccatcacctcttcc 179


>gnl|LJGI|TC78495 homologue to UniRef100_Q4VCL9 Cluster: Plasma membrane H+ ATPase;
           n=1; Lupinus albus|Rep: Plasma membrane H+ ATPase -
           Lupinus albus (White lupin), partial (32%)
          Length = 1367

 Score = 71.9 bits (36), Expect = 4e-12
 Identities = 114/140 (81%)
 Strand = Plus / Plus

                                                                       
Query: 421 tggaagtttgatttctcaccttttatggttctgatcattgccatactaaatgacgggacg 480
           ||||||||||||||  |||| || |||||  |||| |||||||||||||| || || || 
Sbjct: 94  tggaagtttgattttgcacccttcatggtattgataattgccatactaaacgatggtacc 153

                                                                       
Query: 481 atcatgacaatttccaaggatagggtgaagccatctcctcttccggattcatggaagctg 540
           || |||||||| ||||||||| | ||||| ||||||||  | || |||   |||||||||
Sbjct: 154 attatgacaatatccaaggatcgagtgaaaccatctccaatgcccgatagctggaagctg 213

                               
Query: 541 aatgagatctttgccaccgg 560
           || ||||| ||||| |||||
Sbjct: 214 aaggagatatttgcaaccgg 233