Miyakogusa Predicted Gene

Lj3g3v0015480.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v0015480.1 Non Chatacterized Hit- tr|I1M5Y0|I1M5Y0_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.43985
PE,93.55,0,CATATPASE,ATPase, P-type,
K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter; no description,ATPase,  P-type,
cyto,CUFF.40200.1
         (933 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC74406 homologue to UniRef100_Q4VCL8 Cluster: Plasma m...   170   1e-41
gnl|LJGI|TC60156 homologue to UniRef100_Q4VCL9 Cluster: Plasma m...   157   1e-37
gnl|LJGI|AU240120 similar to UniRef100_A7QRZ8 Cluster: Chromosom...    64   2e-09
gnl|LJGI|TC79757 homologue to UniRef100_Q7Y068 Cluster: Plasma m...    56   4e-07
gnl|LJGI|TC59161 homologue to UniRef100_Q6V914 Cluster: Plasma m...    54   2e-06

>gnl|LJGI|TC74406 homologue to UniRef100_Q4VCL8 Cluster: Plasma membrane H+ ATPase;
           n=1; Lupinus albus|Rep: Plasma membrane H+ ATPase -
           Lupinus albus (White lupin), partial (20%)
          Length = 573

 Score =  170 bits (86), Expect = 1e-41
 Identities = 320/398 (80%)
 Strand = Plus / Plus

                                                                       
Query: 181 gtgcacaccttctttggtaaagctgcacacttggtagatagcactaaccaagttggccat 240
           |||||||| ||||| || || || || ||| |||| || || || ||||||||||| |||
Sbjct: 7   gtgcacacgttcttcgggaaggcggctcacgtggtggacagtaccaaccaagttggacat 66

                                                                       
Query: 241 ttccaaaaggtgctgacagctattggtaacttctgcatttgctcaattgctgtgggaatg 300
           ||||| ||||| || ||||||||||| ||||| ||||||  ||| ||||| || || |||
Sbjct: 67  ttccagaaggttctcacagctattgggaacttttgcattgtctccattgcagttggcatg 126

                                                                       
Query: 301 atcatagagcttgttgtcatgtacccaatccagcaccgcaagtataggagtggaatcaac 360
           ||    ||| || | |||||||||||||| |||||||| ||||| ||||  |||||  ||
Sbjct: 127 attgctgagattatagtcatgtacccaattcagcaccggaagtacaggaacggaattgac 186

                                                                       
Query: 361 aatctcttggtgctcctcattggtgggattcctattgccatgccaacagtcttgtcagta 420
           ||  | ||||| ||  | ||||| || ||||| ||||||||||| || || ||||| || 
Sbjct: 187 aacttgttggtcctattgattggaggaattcccattgccatgcctactgtgttgtctgtg 246

                                                                       
Query: 421 acaatggctattggttcccacaggctgtcccagcaaggtgcaatcacaaagagaatgaca 480
           |||||||| |||||||| |||| |||  | ||||||||||| ||||| ||||||||||| 
Sbjct: 247 acaatggccattggttctcacaagctagctcagcaaggtgccatcaccaagagaatgact 306

                                                                       
Query: 481 gccattgaggagatggctgggatggatgtgttgtgcagtgacaagactggcactcttaca 540
           ||||| ||||| |||||||| ||||||||  | |||||||||||||| || || || || 
Sbjct: 307 gccatagaggaaatggctggcatggatgtcctttgcagtgacaagacaggaacactcacc 366

                                                 
Query: 541 ctgaacaagcttactgtggacaagaatttggtagaggt 578
           || ||||| || ||||| |||||||| ||||| |||||
Sbjct: 367 cttaacaaactcactgttgacaagaacttggttgaggt 404


>gnl|LJGI|TC60156 homologue to UniRef100_Q4VCL9 Cluster: Plasma membrane H+ ATPase;
            n=1; Lupinus albus|Rep: Plasma membrane H+ ATPase -
            Lupinus albus (White lupin), partial (32%)
          Length = 1093

 Score =  157 bits (79), Expect = 1e-37
 Identities = 241/295 (81%)
 Strand = Plus / Plus

                                                                        
Query: 160  gctgttgtgatagctactggggtgcacaccttctttggtaaagctgcacacttggtagat 219
            ||||| ||||| |||||||||||||||||||||||||||||||| || ||  |||| |||
Sbjct: 799  gctgtcgtgattgctactggggtgcacaccttctttggtaaagcggctcatctggtcgat 858

                                                                        
Query: 220  agcactaaccaagttggccatttccaaaaggtgctgacagctattggtaacttctgcatt 279
            ||||| ||||||||||| || || || || || || ||||| |||||||| |||||||||
Sbjct: 859  agcaccaaccaagttgggcactttcagaaagtcctcacagcaattggtaatttctgcatt 918

                                                                        
Query: 280  tgctcaattgctgtgggaatgatcatagagcttgttgtcatgtacccaatccagcaccgc 339
            ||||| |||||||| || ||  |||| |||||  | |||||||||||||| || || |||
Sbjct: 919  tgctccattgctgttgggatagtcattgagctcatagtcatgtacccaatacaacatcgc 978

                                                                        
Query: 340  aagtataggagtggaatcaacaatctcttggtgctcctcattggtgggattcctattgcc 399
            ||||| ||   ||| ||  |||||||  |||| ||  | ||||| || ||||| ||||||
Sbjct: 979  aagtacagagatgggattgacaatctgctggttctattgattggaggaattccgattgcc 1038

                                                                   
Query: 400  atgccaacagtcttgtcagtaacaatggctattggttcccacaggctgtcccagc 454
            ||||| || || ||||| || || ||||||||||| || |||||||| |||||||
Sbjct: 1039 atgcctactgttttgtctgttaccatggctattggctctcacaggctttcccagc 1093


>gnl|LJGI|AU240120 similar to UniRef100_A7QRZ8 Cluster: Chromosome undetermined
           scaffold_155, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome undetermined scaffold_155,
           whole genome shotgun sequence - Vitis vinifera (Grape),
           partial (10%)
          Length = 300

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                       
Query: 715 gaggtgcatttcttacccttcaatccagtggacaagcgtacagc 758
           |||||||||||||| ||||||||||||||||| ||||| |||||
Sbjct: 216 gaggtgcatttcttgcccttcaatccagtggataagcgcacagc 259



 Score = 56.0 bits (28), Expect = 4e-07
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 514 tgcagtgacaagactggcactcttacactgaacaagcttactgtggacaaga 565
           |||||||||||||| || ||||| || || || |||||||||||||||||||
Sbjct: 15  tgcagtgacaagaccggaactctcacccttaataagcttactgtggacaaga 66


>gnl|LJGI|TC79757 homologue to UniRef100_Q7Y068 Cluster: Plasma membrane H+-ATPase;
           n=2; Sesbania rostrata|Rep: Plasma membrane H+-ATPase -
           Sesbania rostrata, partial (21%)
          Length = 586

 Score = 56.0 bits (28), Expect = 4e-07
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                       
Query: 484 attgaggagatggctgggatggatgtgttgtgcagtgacaagactggcactcttacactg 543
           |||||||| ||||| |||||||||||  | ||||||||||| ||||| ||||| || |||
Sbjct: 4   attgaggaaatggcagggatggatgtcctctgcagtgacaaaactgggactctgaccctg 63

                   
Query: 544 aacaagct 551
           || |||||
Sbjct: 64  aataagct 71


>gnl|LJGI|TC59161 homologue to UniRef100_Q6V914 Cluster: Plasma membrane H+-ATPase;
           n=1; Juglans regia|Rep: Plasma membrane H+-ATPase -
           Juglans regia (English walnut), partial (22%)
          Length = 851

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                       
Query: 13  gatatcgttccagctgatgctcgtcttttagaaggagatcccctcaagattgatcaatct 72
           ||||| || |||||||||||||| ||| | ||||| |||||  | || |||||||| |||
Sbjct: 715 gatattgtaccagctgatgctcgacttcttgaaggggatcctttgaaaattgatcagtct 774

                                  
Query: 73  gcactcacgggtgagtccttgcc 95
           ||||| || |||||||| |||||
Sbjct: 775 gcacttacaggtgagtctttgcc 797