Miyakogusa Predicted Gene
- Lj3g3v0015480.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v0015480.1 Non Chatacterized Hit- tr|I1M5Y0|I1M5Y0_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.43985
PE,93.55,0,CATATPASE,ATPase, P-type,
K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter; no description,ATPase, P-type,
cyto,CUFF.40200.1
(933 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC74406 homologue to UniRef100_Q4VCL8 Cluster: Plasma m... 170 1e-41
gnl|LJGI|TC60156 homologue to UniRef100_Q4VCL9 Cluster: Plasma m... 157 1e-37
gnl|LJGI|AU240120 similar to UniRef100_A7QRZ8 Cluster: Chromosom... 64 2e-09
gnl|LJGI|TC79757 homologue to UniRef100_Q7Y068 Cluster: Plasma m... 56 4e-07
gnl|LJGI|TC59161 homologue to UniRef100_Q6V914 Cluster: Plasma m... 54 2e-06
>gnl|LJGI|TC74406 homologue to UniRef100_Q4VCL8 Cluster: Plasma membrane H+ ATPase;
n=1; Lupinus albus|Rep: Plasma membrane H+ ATPase -
Lupinus albus (White lupin), partial (20%)
Length = 573
Score = 170 bits (86), Expect = 1e-41
Identities = 320/398 (80%)
Strand = Plus / Plus
Query: 181 gtgcacaccttctttggtaaagctgcacacttggtagatagcactaaccaagttggccat 240
|||||||| ||||| || || || || ||| |||| || || || ||||||||||| |||
Sbjct: 7 gtgcacacgttcttcgggaaggcggctcacgtggtggacagtaccaaccaagttggacat 66
Query: 241 ttccaaaaggtgctgacagctattggtaacttctgcatttgctcaattgctgtgggaatg 300
||||| ||||| || ||||||||||| ||||| |||||| ||| ||||| || || |||
Sbjct: 67 ttccagaaggttctcacagctattgggaacttttgcattgtctccattgcagttggcatg 126
Query: 301 atcatagagcttgttgtcatgtacccaatccagcaccgcaagtataggagtggaatcaac 360
|| ||| || | |||||||||||||| |||||||| ||||| |||| ||||| ||
Sbjct: 127 attgctgagattatagtcatgtacccaattcagcaccggaagtacaggaacggaattgac 186
Query: 361 aatctcttggtgctcctcattggtgggattcctattgccatgccaacagtcttgtcagta 420
|| | ||||| || | ||||| || ||||| ||||||||||| || || ||||| ||
Sbjct: 187 aacttgttggtcctattgattggaggaattcccattgccatgcctactgtgttgtctgtg 246
Query: 421 acaatggctattggttcccacaggctgtcccagcaaggtgcaatcacaaagagaatgaca 480
|||||||| |||||||| |||| ||| | ||||||||||| ||||| |||||||||||
Sbjct: 247 acaatggccattggttctcacaagctagctcagcaaggtgccatcaccaagagaatgact 306
Query: 481 gccattgaggagatggctgggatggatgtgttgtgcagtgacaagactggcactcttaca 540
||||| ||||| |||||||| |||||||| | |||||||||||||| || || || ||
Sbjct: 307 gccatagaggaaatggctggcatggatgtcctttgcagtgacaagacaggaacactcacc 366
Query: 541 ctgaacaagcttactgtggacaagaatttggtagaggt 578
|| ||||| || ||||| |||||||| ||||| |||||
Sbjct: 367 cttaacaaactcactgttgacaagaacttggttgaggt 404
>gnl|LJGI|TC60156 homologue to UniRef100_Q4VCL9 Cluster: Plasma membrane H+ ATPase;
n=1; Lupinus albus|Rep: Plasma membrane H+ ATPase -
Lupinus albus (White lupin), partial (32%)
Length = 1093
Score = 157 bits (79), Expect = 1e-37
Identities = 241/295 (81%)
Strand = Plus / Plus
Query: 160 gctgttgtgatagctactggggtgcacaccttctttggtaaagctgcacacttggtagat 219
||||| ||||| |||||||||||||||||||||||||||||||| || || |||| |||
Sbjct: 799 gctgtcgtgattgctactggggtgcacaccttctttggtaaagcggctcatctggtcgat 858
Query: 220 agcactaaccaagttggccatttccaaaaggtgctgacagctattggtaacttctgcatt 279
||||| ||||||||||| || || || || || || ||||| |||||||| |||||||||
Sbjct: 859 agcaccaaccaagttgggcactttcagaaagtcctcacagcaattggtaatttctgcatt 918
Query: 280 tgctcaattgctgtgggaatgatcatagagcttgttgtcatgtacccaatccagcaccgc 339
||||| |||||||| || || |||| ||||| | |||||||||||||| || || |||
Sbjct: 919 tgctccattgctgttgggatagtcattgagctcatagtcatgtacccaatacaacatcgc 978
Query: 340 aagtataggagtggaatcaacaatctcttggtgctcctcattggtgggattcctattgcc 399
||||| || ||| || ||||||| |||| || | ||||| || ||||| ||||||
Sbjct: 979 aagtacagagatgggattgacaatctgctggttctattgattggaggaattccgattgcc 1038
Query: 400 atgccaacagtcttgtcagtaacaatggctattggttcccacaggctgtcccagc 454
||||| || || ||||| || || ||||||||||| || |||||||| |||||||
Sbjct: 1039 atgcctactgttttgtctgttaccatggctattggctctcacaggctttcccagc 1093
>gnl|LJGI|AU240120 similar to UniRef100_A7QRZ8 Cluster: Chromosome undetermined
scaffold_155, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome undetermined scaffold_155,
whole genome shotgun sequence - Vitis vinifera (Grape),
partial (10%)
Length = 300
Score = 63.9 bits (32), Expect = 2e-09
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 715 gaggtgcatttcttacccttcaatccagtggacaagcgtacagc 758
|||||||||||||| ||||||||||||||||| ||||| |||||
Sbjct: 216 gaggtgcatttcttgcccttcaatccagtggataagcgcacagc 259
Score = 56.0 bits (28), Expect = 4e-07
Identities = 46/52 (88%)
Strand = Plus / Plus
Query: 514 tgcagtgacaagactggcactcttacactgaacaagcttactgtggacaaga 565
|||||||||||||| || ||||| || || || |||||||||||||||||||
Sbjct: 15 tgcagtgacaagaccggaactctcacccttaataagcttactgtggacaaga 66
>gnl|LJGI|TC79757 homologue to UniRef100_Q7Y068 Cluster: Plasma membrane H+-ATPase;
n=2; Sesbania rostrata|Rep: Plasma membrane H+-ATPase -
Sesbania rostrata, partial (21%)
Length = 586
Score = 56.0 bits (28), Expect = 4e-07
Identities = 58/68 (85%)
Strand = Plus / Plus
Query: 484 attgaggagatggctgggatggatgtgttgtgcagtgacaagactggcactcttacactg 543
|||||||| ||||| ||||||||||| | ||||||||||| ||||| ||||| || |||
Sbjct: 4 attgaggaaatggcagggatggatgtcctctgcagtgacaaaactgggactctgaccctg 63
Query: 544 aacaagct 551
|| |||||
Sbjct: 64 aataagct 71
>gnl|LJGI|TC59161 homologue to UniRef100_Q6V914 Cluster: Plasma membrane H+-ATPase;
n=1; Juglans regia|Rep: Plasma membrane H+-ATPase -
Juglans regia (English walnut), partial (22%)
Length = 851
Score = 54.0 bits (27), Expect = 2e-06
Identities = 69/83 (83%)
Strand = Plus / Plus
Query: 13 gatatcgttccagctgatgctcgtcttttagaaggagatcccctcaagattgatcaatct 72
||||| || |||||||||||||| ||| | ||||| ||||| | || |||||||| |||
Sbjct: 715 gatattgtaccagctgatgctcgacttcttgaaggggatcctttgaaaattgatcagtct 774
Query: 73 gcactcacgggtgagtccttgcc 95
||||| || |||||||| |||||
Sbjct: 775 gcacttacaggtgagtctttgcc 797