Miyakogusa Predicted Gene

Lj2g3v3372960.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v3372960.1 tr|D8TMB2|D8TMB2_VOLCA Phosphoglycerate mutase
OS=Volvox carteri GN=pgm3 PE=4 SV=1,36.18,2e-18,Phosphoglycerate
mutase-like,NULL; His_Phos_1,Histidine phosphatase superfamily,
clade-1; no descrip,NODE_58374_length_816_cov_10.247549.path2.1
         (597 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC80322 weakly similar to UniRef100_A7P8P2 Cluster: Chr...   250   9e-66

>gnl|LJGI|TC80322 weakly similar to UniRef100_A7P8P2 Cluster: Chromosome chr3
           scaffold_8, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr3 scaffold_8, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (16%)
          Length = 622

 Score =  250 bits (126), Expect = 9e-66
 Identities = 126/126 (100%)
 Strand = Plus / Plus

                                                                       
Query: 472 caacacaaggaacccgcttatgatgacttagcatcaatactaaatgcagttcaggtggca 531
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   caacacaaggaacccgcttatgatgacttagcatcaatactaaatgcagttcaggtggca 60

                                                                       
Query: 532 ccagtcttgtcacaacaccgcaaatatgctttgcttaccggagagcttaggggagtcctt 591
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ccagtcttgtcacaacaccgcaaatatgctttgcttaccggagagcttaggggagtcctt 120

                 
Query: 592 tgagat 597
           ||||||
Sbjct: 121 tgagat 126