Miyakogusa Predicted Gene

Lj2g3v3338860.3
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v3338860.3 Non Chatacterized Hit- tr|I1M694|I1M694_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max
PE=4,80.97,0,coiled-coil,NULL; Histidine kinase-like
ATPases,ATPase-like, ATP-binding domain; cheY-homologous
rec,CUFF.40055.3
         (1752 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC60023 similar to UniRef100_Q000L4 Cluster: Histidine ...    56   8e-07

>gnl|LJGI|TC60023 similar to UniRef100_Q000L4 Cluster: Histidine kinase 1; n=1; Lupinus
            albus|Rep: Histidine kinase 1 - Lupinus albus (White
            lupin), partial (48%)
          Length = 2350

 Score = 56.0 bits (28), Expect = 8e-07
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                                
Query: 1450 tttgatgcttgtttcatggatctccatatgccagaaatgaatggttttgaag 1501
            |||| ||| |||||||||||| | || |||||||||||| ||||||||||||
Sbjct: 1259 tttggtgcctgtttcatggatattcaaatgccagaaatggatggttttgaag 1310