Miyakogusa Predicted Gene

Lj2g3v3337560.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v3337560.1 Non Chatacterized Hit- tr|I3T0E0|I3T0E0_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2 SV=1,100,0,Chlorophyll
a-b binding protein,Chlorophyll a/b binding protein domain; SUBFAMILY
NOT NAMED,NULL; CH,CUFF.40111.1
         (792 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC68384 homologue to UniRef100_Q93YG3 Cluster: Chloroph...  1570   0.0  
gnl|LJGI|CN825826 similar to UniRef100_Q93YG3 Cluster: Chlorophy...   295   2e-79
gnl|LJGI|TC76198 homologue to UniRef100_P09756 Cluster: Chloroph...   190   9e-48
gnl|LJGI|TC70468 homologue to UniRef100_Q40961 Cluster: Light-ha...   147   1e-34
gnl|LJGI|AV422060 homologue to UniRef100_Q1A179 Cluster: Chlorop...    94   2e-18
gnl|LJGI|AV422513 homologue to UniRef100_P09756 Cluster: Chlorop...    74   1e-12
gnl|LJGI|TC76441 homologue to UniRef100_Q9XQB1 Cluster: LHCII ty...    68   9e-11
gnl|LJGI|AV422722 similar to UniRef100_Q9XQB1 Cluster: LHCII typ...    64   1e-09
gnl|LJGI|TC61949 homologue to UniRef100_A7P1F1 Cluster: Chromoso...    64   1e-09
gnl|LJGI|BP036028 homologue to UniRef100_A7P1F1 Cluster: Chromos...    54   1e-06

>gnl|LJGI|TC68384 homologue to UniRef100_Q93YG3 Cluster: Chlorophyll a/b binding
            protein type II precursor; n=2; eurosids I|Rep:
            Chlorophyll a/b binding protein type II precursor -
            Glycine max (Soybean), complete
          Length = 1345

 Score = 1570 bits (792), Expect = 0.0
 Identities = 792/792 (100%)
 Strand = Plus / Plus

                                                                        
Query: 1    atggccacctctgctatccagcaatcagcattcactggccagactgctttgaagcaggga 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 288  atggccacctctgctatccagcaatcagcattcactggccagactgctttgaagcaggga 347

                                                                        
Query: 61   aatgagctcctccgcaaggctggtggctttggcaaaggtcgctttaccatgcgtcgtact 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 348  aatgagctcctccgcaaggctggtggctttggcaaaggtcgctttaccatgcgtcgtact 407

                                                                        
Query: 121  gtgaagagtgctcctcagagcatttggtatggccctgaccgtcccaagtacttgggtcct 180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 408  gtgaagagtgctcctcagagcatttggtatggccctgaccgtcccaagtacttgggtcct 467

                                                                        
Query: 181  ttctctgagcaaattccatcatacctgactggtgaattccctggtgactacggatgggac 240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 468  ttctctgagcaaattccatcatacctgactggtgaattccctggtgactacggatgggac 527

                                                                        
Query: 241  acagctggattatcagctgaccccgaaaccttcgccaagaaccgtgagctcgaggtgatt 300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 528  acagctggattatcagctgaccccgaaaccttcgccaagaaccgtgagctcgaggtgatt 587

                                                                        
Query: 301  cacagcagatgggccatgcttggtgccttgggatgcaccttcccagaaatccttgaaagg 360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 588  cacagcagatgggccatgcttggtgccttgggatgcaccttcccagaaatccttgaaagg 647

                                                                        
Query: 361  aatggtgtcaaattcggtgaggcagtgtggttcaaggctggtgcccagatcttctctgag 420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 648  aatggtgtcaaattcggtgaggcagtgtggttcaaggctggtgcccagatcttctctgag 707

                                                                        
Query: 421  ggtggccttgactatttaggcaacccaaacctgatccatgctcagagcatccttgcaatc 480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 708  ggtggccttgactatttaggcaacccaaacctgatccatgctcagagcatccttgcaatc 767

                                                                        
Query: 481  tgggctactcaggttgtgctcatgggattaattgaaggctacagggttggtggaggaccc 540
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 768  tgggctactcaggttgtgctcatgggattaattgaaggctacagggttggtggaggaccc 827

                                                                        
Query: 541  cttggtgaaggactagacccactttacccaggtggtgcctttgacccacttggtttggct 600
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 828  cttggtgaaggactagacccactttacccaggtggtgcctttgacccacttggtttggct 887

                                                                        
Query: 601  gatgaccctgatgcatttgcagagttgaaggtgaaggaactcaagaacggtcgattggca 660
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 888  gatgaccctgatgcatttgcagagttgaaggtgaaggaactcaagaacggtcgattggca 947

                                                                        
Query: 661  atgttctccatgtttggcttctttgttcaggccattgttactggcaagggccctattcag 720
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 948  atgttctccatgtttggcttctttgttcaggccattgttactggcaagggccctattcag 1007

                                                                        
Query: 721  aacctttacgaccatgttgctgaccctgttgccaacaatgcttgggcttttgccactaac 780
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1008 aacctttacgaccatgttgctgaccctgttgccaacaatgcttgggcttttgccactaac 1067

                        
Query: 781  ttcgtccctgga 792
            ||||||||||||
Sbjct: 1068 ttcgtccctgga 1079


>gnl|LJGI|CN825826 similar to UniRef100_Q93YG3 Cluster: Chlorophyll a/b binding
           protein type II precursor; n=2; eurosids I|Rep:
           Chlorophyll a/b binding protein type II precursor -
           Glycine max (Soybean), partial (19%)
          Length = 726

 Score =  295 bits (149), Expect = 2e-79
 Identities = 149/149 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggccacctctgctatccagcaatcagcattcactggccagactgctttgaagcaggga 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 34  atggccacctctgctatccagcaatcagcattcactggccagactgctttgaagcaggga 93

                                                                       
Query: 61  aatgagctcctccgcaaggctggtggctttggcaaaggtcgctttaccatgcgtcgtact 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 94  aatgagctcctccgcaaggctggtggctttggcaaaggtcgctttaccatgcgtcgtact 153

                                        
Query: 121 gtgaagagtgctcctcagagcatttggta 149
           |||||||||||||||||||||||||||||
Sbjct: 154 gtgaagagtgctcctcagagcatttggta 182


>gnl|LJGI|TC76198 homologue to UniRef100_P09756 Cluster: Chlorophyll a-b binding
           protein 3, chloroplast precursor; n=1; Glycine max|Rep:
           Chlorophyll a-b binding protein 3, chloroplast precursor
           - Glycine max (Soybean), partial (98%)
          Length = 1119

 Score =  190 bits (96), Expect = 9e-48
 Identities = 467/588 (79%), Gaps = 2/588 (0%)
 Strand = Plus / Plus

                                                                       
Query: 206 tgactggtgaattccctggtgactacggatgggacacagctggattatcagctgaccccg 265
           |||| ||||| ||||| ||||||||||| |||||||| |||||  | || ||||||||||
Sbjct: 271 tgaccggtgagttccccggtgactacggctgggacactgctgggctttctgctgaccccg 330

                                                                       
Query: 266 aaaccttcgccaagaaccgtgagctcgaggtgattcacagcagatgggccatgcttggtg 325
           | || |||||||||||||||||||| |||||||| |||   || ||||||||| | || |
Sbjct: 331 agacattcgccaagaaccgtgagcttgaggtgatccactctaggtgggccatgttgggag 390

                                                                       
Query: 326 ccttgggatgcaccttcccagaaatccttgaaaggaatggtgtcaaattcggtgaggcag 385
           | ||||| ||    ||||||||  || | |   | || || || |||||||||||||| |
Sbjct: 391 ctttgggctgtgttttcccagagctcttggcccgcaacggggttaaattcggtgaggctg 450

                                                                       
Query: 386 tgtggttcaaggctggtgcccagatcttctctgagggtggccttgactatttaggcaacc 445
           ||||||||||||||||  | || ||||||   |||||||| |||||||| || |||||||
Sbjct: 451 tgtggttcaaggctgggtcacaaatcttcagcgagggtgggcttgactacttgggcaacc 510

                                                                       
Query: 446 caaacctgatccatgctcagagcatccttgcaatctgggctactcaggttgtgctcatgg 505
           | | |||| |||| ||||||||||| |||||||| ||||| ||||||||| |  | ||||
Sbjct: 511 cgagcctggtccacgctcagagcattcttgcaatttgggccactcaggttatcttgatgg 570

                                                                       
Query: 506 gattaattgaaggctacagggttggtggaggaccccttggtgaag-gactagacccactt 564
           ||  | |||| || ||| |  ||| ||| || || |||||||| | |||  |||||||| 
Sbjct: 571 gagcagttgagggttaccgtattgctggtgggcctcttggtgaggtgac-cgacccactc 629

                                                                       
Query: 565 tacccaggtggtgcctttgacccacttggtttggctgatgaccctgatgcatttgcagag 624
           |||||||||||   |||||||||| | ||  | ||||||||||| || || ||||| |||
Sbjct: 630 tacccaggtggcagctttgacccattgggccttgctgatgacccagaggcttttgctgag 689

                                                                       
Query: 625 ttgaaggtgaaggaactcaagaacggtcgattggcaatgttctccatgtttggcttcttt 684
            | || ||||||||||||||||| ||  | ||||| |||||||| |||||||| ||||||
Sbjct: 690 cttaaagtgaaggaactcaagaatggaaggttggccatgttctcaatgtttggattcttt 749

                                                                       
Query: 685 gttcaggccattgttactggcaagggccctattcagaacctttacgaccatgttgctgac 744
           ||||| || ||||| || || ||||| ||| |  ||||||||   |||||  || |||||
Sbjct: 750 gttcaagctattgtgaccggaaaggggcctttggagaaccttgcagaccacctttctgac 809

                                                           
Query: 745 cctgttgccaacaatgcttgggcttttgccactaacttcgtccctgga 792
           || |||  ||||||||| ||||| | |||||| ||||| |||||||||
Sbjct: 810 ccagttaacaacaatgcctgggcctatgccaccaactttgtccctgga 857


>gnl|LJGI|TC70468 homologue to UniRef100_Q40961 Cluster: Light-harvesting chlorophyll
           a/b-binding protein precursor; n=1; Prunus persica|Rep:
           Light-harvesting chlorophyll a/b-binding protein
           precursor - Prunus persica (Peach), partial (96%)
          Length = 1079

 Score =  147 bits (74), Expect = 1e-34
 Identities = 469/598 (78%), Gaps = 2/598 (0%)
 Strand = Plus / Plus

                                                                       
Query: 196 ccatcatacctgactggtgaattccctggtgactacggatgggacacagctggattatca 255
           ||||| ||||| |||||||||||||| || ||||| || |||||||| || ||| | || 
Sbjct: 272 ccatcctacctcactggtgaattcccaggcgactatggttgggacactgccggactttct 331

                                                                       
Query: 256 gctgaccccgaaaccttcgccaagaaccgtgagctcgaggtgattcacagcagatgggcc 315
           |||||||| || || || || || |||||||| || ||||| |||||||| |||||||||
Sbjct: 332 gctgacccagagacatttgcgaaaaaccgtgaacttgaggtcattcacagtagatgggcc 391

                                                                       
Query: 316 atgcttggtgccttgggatgcaccttcccagaaatccttgaaaggaatggtgtcaaattc 375
           ||| | || ||| | || ||   |||||| ||  || | |   | || ||||| || || 
Sbjct: 392 atgttgggagccctaggctgtgtcttccccgagctcttggcccgcaacggtgtgaagttt 451

                                                                       
Query: 376 ggtgaggcagtgtggttcaaggctggtgcccagatcttctctgagggtggccttgactat 435
           |||||||| |||||||||||||| ||  |||| || |||  ||| ||||| |||||||| 
Sbjct: 452 ggtgaggctgtgtggttcaaggccgggtcccaaattttcagtgaaggtggacttgactac 511

                                                                       
Query: 436 ttaggcaacccaaacctgatccatgctcagagcatccttgcaatctgggctactcaggtt 495
           || || ||||| | |||  ||||||| || ||||| || ||||||||||| || || |||
Sbjct: 512 ttgggtaacccgagcctagtccatgcacaaagcattctcgcaatctgggccacccaagtt 571

                                                                       
Query: 496 gtgctcatgggattaattgaaggctacagggttggtggaggaccccttggtgaag-gact 554
            |  | |||||     ||||||| ||| |  ||| ||| || || |||||||| | ||||
Sbjct: 572 atcttgatgggtgccgttgaaggttaccgtattgctggtgggccacttggtgaggtgact 631

                                                                       
Query: 555 agacccactttacccaggtggtgcctttgacccacttggtttggctgatgaccctgatgc 614
            |||||||| |||||||||||   |||||||||| | ||  | ||||| ||||| || ||
Sbjct: 632 -gacccactgtacccaggtggcagctttgacccattgggccttgctgacgacccagaagc 690

                                                                       
Query: 615 atttgcagagttgaaggtgaaggaactcaagaacggtcgattggcaatgttctccatgtt 674
            |||||||| ||||||||||| ||||| || || ||| | || || ||||||||||||||
Sbjct: 691 ttttgcagaattgaaggtgaaagaactaaaaaatggtaggttagccatgttctccatgtt 750

                                                                       
Query: 675 tggcttctttgttcaggccattgttactggcaagggccctattcagaacctttacgacca 734
           ||| ||||||||||| || ||||||||||| ||||| ||| |  ||||||||   |||||
Sbjct: 751 tggtttctttgttcaagctattgttactggaaagggacctttggagaaccttgcagacca 810

                                                                     
Query: 735 tgttgctgaccctgttgccaacaatgcttgggcttttgccactaacttcgtccctgga 792
             |||||||||| ||   ||||||||||||||| |||||||| ||||| |||||||||
Sbjct: 811 ccttgctgacccagtcaacaacaatgcttgggcctttgccacaaactttgtccctgga 868


>gnl|LJGI|AV422060 homologue to UniRef100_Q1A179 Cluster: Chloroplast chlorophyll a/b
           binding protein; n=1; Pachysandra terminalis|Rep:
           Chloroplast chlorophyll a/b binding protein -
           Pachysandra terminalis, partial (50%)
          Length = 463

 Score = 93.7 bits (47), Expect = 2e-18
 Identities = 164/203 (80%)
 Strand = Plus / Plus

                                                                       
Query: 195 tccatcatacctgactggtgaattccctggtgactacggatgggacacagctggattatc 254
           |||||| ||||| |||||||| ||||| |||||||| || |||||||| |||||  | ||
Sbjct: 240 tccatcctaccttactggtgagttcccaggtgactatggctgggacactgctgggctttc 299

                                                                       
Query: 255 agctgaccccgaaaccttcgccaagaaccgtgagctcgaggtgattcacagcagatgggc 314
            |||||||| || || || |||||||||||||| || ||||| || ||||| ||||||||
Sbjct: 300 tgctgacccagagacatttgccaagaaccgtgaacttgaggtcatccacagtagatgggc 359

                                                                       
Query: 315 catgcttggtgccttgggatgcaccttcccagaaatccttgaaaggaatggtgtcaaatt 374
           |||| | || |||||||| ||    ||||| ||  || | |   | || |||||||||||
Sbjct: 360 catgttgggagccttgggctgtgttttccctgagctcttggcccgtaacggtgtcaaatt 419

                                  
Query: 375 cggtgaggcagtgtggttcaagg 397
           ||||||||| |||||||||||||
Sbjct: 420 cggtgaggctgtgtggttcaagg 442


>gnl|LJGI|AV422513 homologue to UniRef100_P09756 Cluster: Chlorophyll a-b binding
           protein 3, chloroplast precursor; n=1; Glycine max|Rep:
           Chlorophyll a-b binding protein 3, chloroplast precursor
           - Glycine max (Soybean), partial (18%)
          Length = 213

 Score = 73.8 bits (37), Expect = 1e-12
 Identities = 70/81 (86%)
 Strand = Plus / Plus

                                                                       
Query: 206 tgactggtgaattccctggtgactacggatgggacacagctggattatcagctgaccccg 265
           |||| ||||| ||||| ||||||||||| |||||||| |||||  | || ||||||||||
Sbjct: 133 tgaccggtgagttccccggtgactacggctgggacactgctgggctttctgctgaccccg 192

                                
Query: 266 aaaccttcgccaagaaccgtg 286
           | || ||||||||||||||||
Sbjct: 193 agacattcgccaagaaccgtg 213


>gnl|LJGI|TC76441 homologue to UniRef100_Q9XQB1 Cluster: LHCII type III chlorophyll
           a/b binding protein; n=1; Vigna radiata var.
           radiata|Rep: LHCII type III chlorophyll a/b binding
           protein - Phaseolus aureus (Mung bean) (Vigna radiata),
           complete
          Length = 1198

 Score = 67.9 bits (34), Expect = 9e-11
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 655 ttggcaatgttctccatgtttggcttctttgttcaggccattgttactgg 704
           ||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 834 ttggccatgttctccatgtttggtttctttgttcaagccattgtcactgg 883



 Score = 63.9 bits (32), Expect = 1e-09
 Identities = 71/84 (84%)
 Strand = Plus / Plus

                                                                       
Query: 199 tcatacctgactggtgaattccctggtgactacggatgggacacagctggattatcagct 258
           |||||| | ||||| |||||||| ||||| || ||||||||||| ||||| ||||| |||
Sbjct: 372 tcatacttaactggagaattcccaggtgattatggatgggacactgctgggttatctgct 431

                                   
Query: 259 gaccccgaaaccttcgccaagaac 282
           ||||| ||| | || |||||||||
Sbjct: 432 gaccctgaagcatttgccaagaac 455


>gnl|LJGI|AV422722 similar to UniRef100_Q9XQB1 Cluster: LHCII type III chlorophyll a/b
           binding protein; n=1; Vigna radiata var. radiata|Rep:
           LHCII type III chlorophyll a/b binding protein -
           Phaseolus aureus (Mung bean) (Vigna radiata), partial
           (50%)
          Length = 521

 Score = 63.9 bits (32), Expect = 1e-09
 Identities = 71/84 (84%)
 Strand = Plus / Plus

                                                                       
Query: 199 tcatacctgactggtgaattccctggtgactacggatgggacacagctggattatcagct 258
           |||||| | ||||| |||||||| ||||| || ||||||||||| ||||| ||||| |||
Sbjct: 322 tcatacttaactggagaattcccaggtgattatggatgggacactgctgggttatctgct 381

                                   
Query: 259 gaccccgaaaccttcgccaagaac 282
           ||||| ||| | || |||||||||
Sbjct: 382 gaccctgaagcatttgccaagaac 405


>gnl|LJGI|TC61949 homologue to UniRef100_A7P1F1 Cluster: Chromosome chr19 scaffold_4,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr19 scaffold_4, whole genome shotgun
           sequence - Vitis vinifera (Grape), complete
          Length = 1085

 Score = 63.9 bits (32), Expect = 1e-09
 Identities = 98/120 (81%)
 Strand = Plus / Plus

                                                                       
Query: 579 ctttgacccacttggtttggctgatgaccctgatgcatttgcagagttgaaggtgaagga 638
           ||||||||| |||||  | |||||||||||||   | ||||| ||| | ||||| |||||
Sbjct: 598 ctttgaccctcttggccttgctgatgaccctgtcacttttgctgagcttaaggttaagga 657

                                                                       
Query: 639 actcaagaacggtcgattggcaatgttctccatgtttggcttctttgttcaggccattgt 698
             ||||||| ||  | ||||| ||||||||||||||||| |||||||| || ||||||||
Sbjct: 658 gatcaagaatggaaggttggccatgttctccatgtttggtttctttgtccaagccattgt 717



 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 206 tgactggtgaattccctggtgactacggatgggacacagctggattatcagctga 260
           ||||||| |||||||| || ||||| ||||||||||| |||||||| || |||||
Sbjct: 219 tgactggagaattcccaggggactatggatgggacactgctggattgtctgctga 273



 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 75/91 (82%)
 Strand = Plus / Plus

                                                                       
Query: 383 cagtgtggttcaaggctggtgcccagatcttctctgagggtggccttgactatttaggca 442
           |||| |||||||| ||||| || ||||| ||||| || |||||||||||||| || || |
Sbjct: 399 cagtttggttcaaagctggagctcagatattctcagaaggtggccttgactacttgggga 458

                                          
Query: 443 acccaaacctgatccatgctcagagcatcct 473
           | || |||||  | ||||| |||||||||||
Sbjct: 459 atcccaaccttgttcatgcacagagcatcct 489


>gnl|LJGI|BP036028 homologue to UniRef100_A7P1F1 Cluster: Chromosome chr19 scaffold_4,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr19 scaffold_4, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (45%)
          Length = 483

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 199 tcatacctgactggtgaattccctggtgactacggatgggacacagctggattatcagct 258
           |||||| ||||||| |||||||| |  ||||| ||||||||||| |||||||| || |||
Sbjct: 316 tcatacttgactggagaattcccagnggactatggatgggacactgctggattgtctgct 375

             
Query: 259 ga 260
           ||
Sbjct: 376 ga 377