Miyakogusa Predicted Gene

Lj2g3v3318950.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v3318950.1 Non Chatacterized Hit- tr|C4M4M0|C4M4M0_ENTHI
Myotubularin-related protein 2, putative OS=Entamoeba ,28.95,4.8,
,CUFF.40067.1
         (281 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS336503 similar to UniRef100_A1TQY3 Cluster: Pyridoxam...    88   3e-17

>gnl|LJGI|FS336503 similar to UniRef100_A1TQY3 Cluster: Pyridoxamine 5'-phosphate
           oxidase; n=1; Acidovorax avenae subsp. citrulli
           AAC00-1|Rep: Pyridoxamine 5'-phosphate oxidase -
           Acidovorax avenae subsp. citrulli (strain AAC00-1),
           partial (6%)
          Length = 779

 Score = 87.7 bits (44), Expect = 3e-17
 Identities = 56/60 (93%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggctttctttcaatcccactcctataaatactcctatgcttttggagagtgtgtgttc 60
           |||||||||||||| |||||||||||||||||||||| |||||||  |||||||||||||
Sbjct: 454 atggctttctttcattcccactcctataaatactcctttgcttttctagagtgtgtgttc 513