Miyakogusa Predicted Gene
- Lj2g3v3318950.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v3318950.1 Non Chatacterized Hit- tr|C4M4M0|C4M4M0_ENTHI
Myotubularin-related protein 2, putative OS=Entamoeba ,28.95,4.8,
,CUFF.40067.1
(281 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|FS336503 similar to UniRef100_A1TQY3 Cluster: Pyridoxam... 88 3e-17
>gnl|LJGI|FS336503 similar to UniRef100_A1TQY3 Cluster: Pyridoxamine 5'-phosphate
oxidase; n=1; Acidovorax avenae subsp. citrulli
AAC00-1|Rep: Pyridoxamine 5'-phosphate oxidase -
Acidovorax avenae subsp. citrulli (strain AAC00-1),
partial (6%)
Length = 779
Score = 87.7 bits (44), Expect = 3e-17
Identities = 56/60 (93%)
Strand = Plus / Plus
Query: 1 atggctttctttcaatcccactcctataaatactcctatgcttttggagagtgtgtgttc 60
|||||||||||||| |||||||||||||||||||||| ||||||| |||||||||||||
Sbjct: 454 atggctttctttcattcccactcctataaatactcctttgcttttctagagtgtgtgttc 513