Miyakogusa Predicted Gene

Lj2g3v3248940.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v3248940.1 Non Chatacterized Hit- tr|I1M6I7|I1M6I7_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.46432 PE,71.57,0,no
description,Nucleotide-binding, alpha-beta plait; RRM,RNA recognition
motif domain; ZF_C3H1,Zinc ,CUFF.39930.1
         (1539 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC81652 similar to UniRef100_Q6T284 Cluster: Predicted ...    86   8e-16

>gnl|LJGI|TC81652 similar to UniRef100_Q6T284 Cluster: Predicted protein; n=1; Populus
            tremula x Populus alba|Rep: Predicted protein - Populus
            tremula x Populus alba, partial (35%)
          Length = 981

 Score = 85.7 bits (43), Expect = 8e-16
 Identities = 112/135 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1003 atatatttgacatttccagctgacagcactttcacagaggaagatgtctcagactacttc 1062
            ||||| ||||| |||||||| || |||||||||| |||||||||||| ||| ||||||||
Sbjct: 591  atatacttgacttttccagcagatagcactttcagagaggaagatgtttcaaactacttc 650

                                                                        
Query: 1063 aacacatttgggtgtgttgaagatgttaggatcccgtgccagcagagaaggatgtttgga 1122
            | ||  |  |||  |||| |||||||||||||||| |  ||||| | | |||||||||||
Sbjct: 651  agcatctacgggcctgttcaagatgttaggatcccatatcagcaaaaacggatgtttgga 710

                           
Query: 1123 tttgtgacttttgct 1137
            ||||| || ||||||
Sbjct: 711  tttgttacctttgct 725