Miyakogusa Predicted Gene
- Lj2g3v3248940.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v3248940.1 Non Chatacterized Hit- tr|I1M6I7|I1M6I7_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.46432 PE,71.57,0,no
description,Nucleotide-binding, alpha-beta plait; RRM,RNA recognition
motif domain; ZF_C3H1,Zinc ,CUFF.39930.1
(1539 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC81652 similar to UniRef100_Q6T284 Cluster: Predicted ... 86 8e-16
>gnl|LJGI|TC81652 similar to UniRef100_Q6T284 Cluster: Predicted protein; n=1; Populus
tremula x Populus alba|Rep: Predicted protein - Populus
tremula x Populus alba, partial (35%)
Length = 981
Score = 85.7 bits (43), Expect = 8e-16
Identities = 112/135 (82%)
Strand = Plus / Plus
Query: 1003 atatatttgacatttccagctgacagcactttcacagaggaagatgtctcagactacttc 1062
||||| ||||| |||||||| || |||||||||| |||||||||||| ||| ||||||||
Sbjct: 591 atatacttgacttttccagcagatagcactttcagagaggaagatgtttcaaactacttc 650
Query: 1063 aacacatttgggtgtgttgaagatgttaggatcccgtgccagcagagaaggatgtttgga 1122
| || | ||| |||| |||||||||||||||| | ||||| | | |||||||||||
Sbjct: 651 agcatctacgggcctgttcaagatgttaggatcccatatcagcaaaaacggatgtttgga 710
Query: 1123 tttgtgacttttgct 1137
||||| || ||||||
Sbjct: 711 tttgttacctttgct 725