Miyakogusa Predicted Gene
- Lj2g3v3246850.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v3246850.1 Non Chatacterized Hit- tr|F6I2C9|F6I2C9_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,46,0.21,SUBTILISIN-LIKE PROTEASE (PLANT),NULL; PROPROTEIN
CONVERTASE SUBTILISIN/KEXIN,Peptidase S8, subtilis,CUFF.39933.1
(996 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|DC593393 similar to UniRef100_A7Q9H4 Cluster: Chromosom... 58 1e-07
gnl|LJGI|GO024409 similar to UniRef100_A7Q9H4 Cluster: Chromosom... 52 7e-06
gnl|LJGI|FS341341 similar to UniRef100_A7Q2V8 Cluster: Chromosom... 52 7e-06
gnl|LJGI|TC69125 similar to UniRef100_A7Q9H4 Cluster: Chromosome... 52 7e-06
gnl|LJGI|TC60447 similar to UniRef100_A2Q1V2 Cluster: Peptidase ... 52 7e-06
>gnl|LJGI|DC593393 similar to UniRef100_A7Q9H4 Cluster: Chromosome chr19 scaffold_66,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr19 scaffold_66, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (19%)
Length = 580
Score = 58.0 bits (29), Expect = 1e-07
Identities = 59/69 (85%)
Strand = Plus / Plus
Query: 90 aagatatggtgaaggcacaatcattggtaaccttgattcaggtgtatggccagaatccaa 149
||||| ||||||| ||||||||| |||| | ||||| ||||||| ||||| ||||| ||
Sbjct: 448 aagatttggtgaaaacacaatcataggtagcattgatacaggtgtttggcctgaatcaaa 507
Query: 150 gagttttag 158
|||||||||
Sbjct: 508 gagttttag 516
Score = 52.0 bits (26), Expect = 7e-06
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 8 aactgcacactacccggtcatgggaatttcttgg 41
|||||||||||||||| |||||||| ||||||||
Sbjct: 363 aactgcacactacccgttcatgggagtttcttgg 396
>gnl|LJGI|GO024409 similar to UniRef100_A7Q9H4 Cluster: Chromosome chr19 scaffold_66,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr19 scaffold_66, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (19%)
Length = 707
Score = 52.0 bits (26), Expect = 7e-06
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 11 tgcacactacccggtcatgggaatttcttggact 44
||||||||||||| |||||||| |||||||||||
Sbjct: 386 tgcacactacccgttcatgggagtttcttggact 419
>gnl|LJGI|FS341341 similar to UniRef100_A7Q2V8 Cluster: Chromosome chr12 scaffold_47,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr12 scaffold_47, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (21%)
Length = 749
Score = 52.0 bits (26), Expect = 7e-06
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 8 aactgcacactacccggtcatgggaatttcttgg 41
|||||||||||||||| |||||||| ||||||||
Sbjct: 376 aactgcacactacccgttcatgggagtttcttgg 409
>gnl|LJGI|TC69125 similar to UniRef100_A7Q9H4 Cluster: Chromosome chr19 scaffold_66,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr19 scaffold_66, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (13%)
Length = 588
Score = 52.0 bits (26), Expect = 7e-06
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 11 tgcacactacccggtcatgggaatttcttggact 44
||||||||||||| |||||||| |||||||||||
Sbjct: 518 tgcacactacccgttcatgggagtttcttggact 551
>gnl|LJGI|TC60447 similar to UniRef100_A2Q1V2 Cluster: Peptidase S8 and S53,
subtilisin, kexin, sedolisin; n=1; Medicago
truncatula|Rep: Peptidase S8 and S53, subtilisin, kexin,
sedolisin - Medicago truncatula (Barrel medic), partial
(59%)
Length = 1964
Score = 52.0 bits (26), Expect = 7e-06
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 11 tgcacactacccggtcatgggaatttcttggact 44
||||||||||||| |||||||| |||||||||||
Sbjct: 405 tgcacactacccgttcatgggagtttcttggact 438