Miyakogusa Predicted Gene

Lj2g3v3224230.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v3224230.1 Non Chatacterized Hit- tr|C5XMX7|C5XMX7_SORBI
Putative uncharacterized protein Sb03g024496 (Fragment,27.27,4.9,
,CUFF.40008.1
         (205 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AV407242 similar to UniRef100_A3FK35 Cluster: Gly rich ...    50   5e-06

>gnl|LJGI|AV407242 similar to UniRef100_A3FK35 Cluster: Gly rich salivary protein;
           n=1; Oncopeltus fasciatus|Rep: Gly rich salivary protein
           - Oncopeltus fasciatus (Milkweed bug), partial (28%)
          Length = 320

 Score = 50.1 bits (25), Expect = 5e-06
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 134 aaggtagtggtggcggcgcagccatggatgaag 166
           ||||||||||||||||||| |||||| ||||||
Sbjct: 72  aaggtagtggtggcggcgcggccatgaatgaag 40