Miyakogusa Predicted Gene

Lj2g3v3106320.1
Show Alignment:  
BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v3106320.1 Non Chatacterized Hit- tr|I1M6X4|I1M6X4_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,82.62,0,Glycerol-3-phosphate (1)-acyltransferase,NULL; Phosphate
acyltransferases,Phospholipid/glycerol acyl,CUFF.39721.1
         (1623 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC68516 similar to UniRef100_Q9SHJ5 Cluster: Glycerol-3...    64   3e-09

>gnl|LJGI|TC68516 similar to UniRef100_Q9SHJ5 Cluster: Glycerol-3-phosphate
            acyltransferase 1; n=2; Arabidopsis thaliana|Rep:
            Glycerol-3-phosphate acyltransferase 1 - Arabidopsis
            thaliana (Mouse-ear cress), partial (26%)
          Length = 732

 Score = 63.9 bits (32), Expect = 3e-09
 Identities = 113/140 (80%)
 Strand = Plus / Plus

                                                                        
Query: 1222 gtggtgtgtcctgaaggaacaacttgtagggagccatatttgttaagattcagctcattg 1281
            ||||| |||||||| ||||||||||| ||||| || ||||||||||| || ||  | |||
Sbjct: 124  gtggtttgtcctgagggaacaacttgcagggaaccttatttgttaaggtttagtcccttg 183

                                                                        
Query: 1282 tttgctgaattagctgatgagattgtccctgtggctatgaatgctcatgttaacatgttc 1341
            ||||||||| |  | ||||| ||||| ||||| ||| || |||   | |||| |||||||
Sbjct: 184  tttgctgaactcacagatgatattgttcctgttgctgtggatgtgaaagttagcatgttc 243

                                
Query: 1342 tatgggaccacagcaagtgg 1361
            ||||| || ||||| |||||
Sbjct: 244  tatggaacaacagctagtgg 263