Miyakogusa Predicted Gene

Lj2g3v3101760.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v3101760.1 Non Chatacterized Hit- tr|I1M6Y2|I1M6Y2_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,85.07,0,no
description,NULL; SUCROSE-PHOSPHATE SYNTHASE,NULL;
GLYCOSYLTRANSFERASE,NULL; Glycos_transf_1,Glyc,gene.g44188.t1.1
         (3147 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS325282 similar to UniRef100_Q9SN30 Cluster: Sucrose-p...    90   1e-16

>gnl|LJGI|FS325282 similar to UniRef100_Q9SN30 Cluster: Sucrose-phosphate
           synthase-like protein; n=1; Arabidopsis thaliana|Rep:
           Sucrose-phosphate synthase-like protein - Arabidopsis
           thaliana (Mouse-ear cress), partial (21%)
          Length = 742

 Score = 89.7 bits (45), Expect = 1e-16
 Identities = 78/89 (87%)
 Strand = Plus / Plus

                                                                       
Query: 514 catggattggttcgaggagaaaacatggagcttggtcgagattctgataccggtggacag 573
           ||||| ||||| ||||||||||| ||||| |||||  ||||||||||||| ||||| |||
Sbjct: 250 catggtttggtacgaggagaaaatatggaacttgggagagattctgatactggtggccag 309

                                        
Query: 574 attaaatatgtggtagaacttgctcgtgc 602
            | |||||||| |||||||||||||||||
Sbjct: 310 gtcaaatatgtagtagaacttgctcgtgc 338



 Score = 77.8 bits (39), Expect = 4e-13
 Identities = 84/99 (84%)
 Strand = Plus / Plus

                                                                        
Query: 904  tggccatatgtgattcatggacactatgctgatgctggagacagtgctgctcttctttca 963
            ||||| ||||| || ||||| |||||||||||||||||||| | ||| |||| | | || 
Sbjct: 628  tggccttatgttatccatggtcactatgctgatgctggagagattgcagctcatttatcc 687

                                                   
Query: 964  ggagctttgaatgtgccaatggtgctcacaggtcattca 1002
            || || ||||||||||| |||||||| ||||||||||||
Sbjct: 688  ggtgcgttgaatgtgcctatggtgctaacaggtcattca 726