Miyakogusa Predicted Gene
- Lj2g3v3084240.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v3084240.1 tr|G7JVS3|G7JVS3_MEDTR NBS-containing
resistance-like protein OS=Medicago truncatula
GN=MTR_4g023040,38.12,3e-18,L domain-like,NULL; DISEASE RESISTANCE
PROTEIN (TIR-NBS-LRR CLASS), PUTATIVE,NULL; LEUCINE-RICH
REPE,gene.g44154.t1.1
(1845 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC82666 66 8e-10
gnl|LJGI|TC66833 64 3e-09
>gnl|LJGI|TC82666
Length = 710
Score = 65.9 bits (33), Expect = 8e-10
Identities = 57/65 (87%)
Strand = Plus / Minus
Query: 888 tagttggggtgttcatgtatacaaacaagaaaccaaaatggaagatgtcaggttcatgtg 947
||||||||| ||| |||| |||| |||||||||||| |||||||||||| | |||||||
Sbjct: 325 tagttggggggtttatgtgtacagacaagaaaccaacatggaagatgtccagctcatgtg 266
Query: 948 tcctg 952
|||||
Sbjct: 265 tcctg 261
>gnl|LJGI|TC66833
Length = 691
Score = 63.9 bits (32), Expect = 3e-09
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 1183 gctgctcctgatgaattagatatttggaaacatgaatatcatga 1226
|||||||| ||||||||||||| |||||||||| ||||||||||
Sbjct: 296 gctgctccggatgaattagatagttggaaacatcaatatcatga 339