Miyakogusa Predicted Gene

Lj2g3v3084230.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v3084230.1 tr|G7K3B3|G7K3B3_MEDTR CCP OS=Medicago truncatula
GN=MTR_5g090940 PE=4 SV=1,63.76,0,seg,NULL; P-loop containing
nucleoside triphosphate hydrolases,NULL; DISEASERSIST,Disease
resistance,gene.g44153.t1.1
         (699 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS341004 weakly similar to UniRef100_Q9FVK2 Cluster: Re...   133   2e-30
gnl|LJGI|TC75936 similar to UniRef100_A5JS46 Cluster: NBS-LRR re...    96   4e-19
gnl|LJGI|BP064315 similar to UniRef100_Q2KPY3 Cluster: Resistanc...    62   5e-09

>gnl|LJGI|FS341004 weakly similar to UniRef100_Q9FVK2 Cluster: Resistance protein
           MG13; n=1; Glycine max|Rep: Resistance protein MG13 -
           Glycine max (Soybean), partial (28%)
          Length = 770

 Score =  133 bits (67), Expect = 2e-30
 Identities = 91/99 (91%)
 Strand = Plus / Plus

                                                                       
Query: 64  aagataatttctaaacctcttcaaggtaaggacccagttggatttgagcaacgcatagaa 123
           |||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||
Sbjct: 625 aagataatttctaaaccttttcatggtaaggacccagttggatttgagcaacgcatagaa 684

                                                  
Query: 124 gaggtgaagtcactactagacatgaagcctgatgatgat 162
           ||||| || ||||| ||||| ||||| | ||||||||||
Sbjct: 685 gaggtaaattcacttctagaaatgaatcttgatgatgat 723


>gnl|LJGI|TC75936 similar to UniRef100_A5JS46 Cluster: NBS-LRR resistance-like
           protein RGC754; n=1; Helianthus tuberosus|Rep: NBS-LRR
           resistance-like protein RGC754 - Helianthus tuberosus
           (Jerusalem artichoke), partial (61%)
          Length = 749

 Score = 95.6 bits (48), Expect = 4e-19
 Identities = 89/100 (89%), Gaps = 2/100 (2%)
 Strand = Plus / Plus

                                                                       
Query: 431 ttcttgatgatgttgatgacatagaacaattg-aataacttggcaggaggatgtgattgg 489
           |||| |||||||||||||| |||||||||||| ||  ||||| | |||||||||||||||
Sbjct: 484 ttctggatgatgttgatgatatagaacaattggaagcacttgcc-ggaggatgtgattgg 542

                                                   
Query: 490 tttggtttaggtagcagaatcattataacaacaagggatg 529
           |||||||  |||||||| ||||||||||||||||| ||||
Sbjct: 543 tttggttccggtagcaggatcattataacaacaagagatg 582


>gnl|LJGI|BP064315 similar to UniRef100_Q2KPY3 Cluster: Resistance protein PLTR; n=1;
           Arachis hypogaea|Rep: Resistance protein PLTR - Arachis
           hypogaea (Peanut), partial (46%)
          Length = 350

 Score = 61.9 bits (31), Expect = 5e-09
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 482 gtgattggtttggtttaggtagcagaatcattataacaacaagggat 528
           |||||||||||||||  |||||||| ||||| |||||||||||||||
Sbjct: 143 gtgattggtttggttctggtagcaggatcatcataacaacaagggat 189