Miyakogusa Predicted Gene

Lj2g3v3084020.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v3084020.1 tr|G7K3B3|G7K3B3_MEDTR CCP OS=Medicago truncatula
GN=MTR_5g090940 PE=4 SV=1,38.73,0.00000000000004, ,gene.g44150.t1.1
         (618 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC82666                                                       66   3e-10
gnl|LJGI|GO014712                                                      54   1e-06

>gnl|LJGI|TC82666 
          Length = 710

 Score = 65.9 bits (33), Expect = 3e-10
 Identities = 110/133 (82%), Gaps = 2/133 (1%)
 Strand = Plus / Minus

                                                                       
Query: 405 ggggctttatgatactgggattgaaggctttcacaacacactagagtttcaagatctgat 464
           ||||||||||||| ||| |||||||| ||| || ||| | | ||||| |||  |||||||
Sbjct: 131 ggggctttatgatgctgagattgaagtcttccagaactc-caagagtctcatcatctgat 73

                                                                       
Query: 465 gagtgcggcatatttgaagggagtgagggatggagtccttggagcacaggccaccttggt 524
           ||||||  | || ||||| ||| | |||||||||||||| | |||||| |||| |||| |
Sbjct: 72  gagtgcaacgtacttgaatggact-agggatggagtcctcgaagcacatgccatcttgtt 14

                        
Query: 525 tgctctggacatg 537
           |||||||||||||
Sbjct: 13  tgctctggacatg 1



 Score = 61.9 bits (31), Expect = 4e-09
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 91  ggcaaggccttgatgcacttcttgtgtgtgattggaatcaagtgcag 137
           |||||||||||||||||||||| | |  |||||||||||||||||||
Sbjct: 406 ggcaaggccttgatgcacttctggggcatgattggaatcaagtgcag 360


>gnl|LJGI|GO014712 
          Length = 219

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 461 tgatgagtgcggcatatttgaagggagtgagggatggagtccttggagcac 511
           |||||||||| | ||||||  | |||||||||||||||||||||| |||||
Sbjct: 178 tgatgagtgcagtatatttccaaggagtgagggatggagtccttgaagcac 128