Miyakogusa Predicted Gene
- Lj2g3v3022790.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v3022790.1 Non Chatacterized Hit- tr|Q2QQL7|Q2QQL7_ORYSJ
Retrotransposon protein, putative, Ty1-copia subclass
,49.41,2e-19,PREDICTED PROTEIN (FRAGMENT),NULL; GAG-POL-RELATED
RETROTRANSPOSON,NULL,CUFF.39604.1
(261 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BP057233 52 2e-06
>gnl|LJGI|BP057233
Length = 473
Score = 52.0 bits (26), Expect = 2e-06
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 211 gttgttgcttatgtaccaactgcagatcaaactgcagattgtctcaccaa 260
||||| |||||||| || || ||||||||| ||||||||||||||||||
Sbjct: 325 gttgtggcttatgtccctacaacagatcaaattgcagattgtctcaccaa 276