Miyakogusa Predicted Gene
- Lj2g3v3007310.2
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v3007310.2 tr|G7KCR9|G7KCR9_MEDTR Tyrosine-specific
transport protein OS=Medicago truncatula GN=MTR_5g088730
PE,79.28,0,Trp_Tyr_perm,Tryptophan/tyrosine permease; SUBFAMILY NOT
NAMED,NULL; FAMILY NOT NAMED,NULL; seg,NULL,CUFF.39574.2
(1458 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BP049806 similar to UniRef100_A4L9L2 Cluster: VSPase; n... 196 3e-49
>gnl|LJGI|BP049806 similar to UniRef100_A4L9L2 Cluster: VSPase; n=1; Staphylococcus
aureus|Rep: VSPase - Staphylococcus aureus, partial (3%)
Length = 237
Score = 196 bits (99), Expect = 3e-49
Identities = 99/99 (100%)
Strand = Plus / Minus
Query: 1360 gaactagttccaggagggaggataaccctactacttgtgcttggaggttcaggatttgtc 1419
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 237 gaactagttccaggagggaggataaccctactacttgtgcttggaggttcaggatttgtc 178
Query: 1420 attgtttctgaattaattgagaacttgcagcacctatga 1458
|||||||||||||||||||||||||||||||||||||||
Sbjct: 177 attgtttctgaattaattgagaacttgcagcacctatga 139