Miyakogusa Predicted Gene

Lj2g3v2984880.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v2984880.1 Non Chatacterized Hit- tr|I1JIQ8|I1JIQ8_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,80.98,0,Pkinase_Tyr,Serine-threonine/tyrosine-protein kinase
catalytic domain; LRR_1,Leucine-rich repeat; LR,CUFF.39554.1
         (3048 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC82695 similar to UniRef100_A5YJW0 Cluster: LYK11; n=1...    54   5e-06

>gnl|LJGI|TC82695 similar to UniRef100_A5YJW0 Cluster: LYK11; n=1; Glycine max|Rep:
            LYK11 - Glycine max (Soybean), partial (28%)
          Length = 814

 Score = 54.0 bits (27), Expect = 5e-06
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                       
Query: 2751 aagtgatgtctatgcatttggtgttgt 2777
            |||||||||||||||||||||||||||
Sbjct: 305  aagtgatgtctatgcatttggtgttgt 331