Miyakogusa Predicted Gene

Lj2g3v2879530.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v2879530.1 tr|G7K7I8|G7K7I8_MEDTR Subtilisin-like protease
OS=Medicago truncatula GN=MTR_5g085690 PE=4
SV=1,78.78,0,Peptidase_S8,Peptidase S8/S53,
subtilisin/kexin/sedolisin; no description,Peptidase S8/S53,
subtilis,CUFF.39392.1
         (735 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO012299 similar to UniRef100_A2Q1V2 Cluster: Peptidase...   129   3e-29
gnl|LJGI|TC60447 similar to UniRef100_A2Q1V2 Cluster: Peptidase ...   113   2e-24
gnl|LJGI|BP075672 similar to UniRef100_Q84TU2 Cluster: Subtilisi...    98   9e-20
gnl|LJGI|TC63919 similar to UniRef100_A2Q1V2 Cluster: Peptidase ...    84   1e-15

>gnl|LJGI|GO012299 similar to UniRef100_A2Q1V2 Cluster: Peptidase S8 and S53,
           subtilisin, kexin, sedolisin; n=1; Medicago
           truncatula|Rep: Peptidase S8 and S53, subtilisin, kexin,
           sedolisin - Medicago truncatula (Barrel medic), partial
           (26%)
          Length = 729

 Score =  129 bits (65), Expect = 3e-29
 Identities = 226/279 (81%), Gaps = 3/279 (1%)
 Strand = Plus / Plus

                                                                       
Query: 216 acaaggaacttctatgtcttgccctcatgttgctggcattgttggtcttctcaagacact 275
           |||||||||||| |||||||||||||||||| |||| |||| ||| ||  | ||||||||
Sbjct: 387 acaaggaacttccatgtcttgccctcatgtttctggtattgctggactaattaagacact 446

                                                                       
Query: 276 tcatcctaaatggagtccagcagctatcaagtcagccatcatgacaacagctaccactct 335
           ||||||||| ||||||||| | ||||| || ||||| |||||||| ||||| |  ||   
Sbjct: 447 tcatcctaattggagtccatctgctattaaatcagcaatcatgaccacagcaagtacaag 506

                                                                       
Query: 336 agataacaccaatcgaccgattcataacgcatttgatca---gttagcaactccacttga 392
           ||||||||||||  | || || ||  |||| |||||| |    |||||||| ||| ||| 
Sbjct: 507 agataacaccaacaggcctatacaagacgcgtttgatgaaacattagcaacaccatttgc 566

                                                                       
Query: 393 atatggttcaggacatgtgcagcctaacctggcagtagaccctgggcttgtttatgatct 452
             |||||||||||||||| || ||||||   ||| | || ||||||||||||||||||||
Sbjct: 567 tcatggttcaggacatgttcaacctaacagtgcaattgatcctgggcttgtttatgatct 626

                                                  
Query: 453 aagcataacagactacttgaacttcatatgtgcttctgg 491
           ||||||    || |||||||||||| |||||||||||||
Sbjct: 627 aagcattgttgattacttgaacttcttatgtgcttctgg 665


>gnl|LJGI|TC60447 similar to UniRef100_A2Q1V2 Cluster: Peptidase S8 and S53,
            subtilisin, kexin, sedolisin; n=1; Medicago
            truncatula|Rep: Peptidase S8 and S53, subtilisin, kexin,
            sedolisin - Medicago truncatula (Barrel medic), partial
            (59%)
          Length = 1964

 Score =  113 bits (57), Expect = 2e-24
 Identities = 96/109 (88%)
 Strand = Plus / Plus

                                                                        
Query: 217  caaggaacttctatgtcttgccctcatgttgctggcattgttggtcttctcaagacactt 276
            ||||||||||| |||||||||||||||||||||||||| | ||| ||| | || ||||||
Sbjct: 1778 caaggaacttccatgtcttgccctcatgttgctggcatcgctggacttattaaaacactt 1837

                                                             
Query: 277  catcctaaatggagtccagcagctatcaagtcagccatcatgacaacag 325
            |||||||| |||||||| || |||||||| ||||| |||||||| ||||
Sbjct: 1838 catcctaattggagtccggccgctatcaaatcagcaatcatgacgacag 1886


>gnl|LJGI|BP075672 similar to UniRef100_Q84TU2 Cluster: Subtilisin-like seed-specific
           protein; n=1; Arachis hypogaea|Rep: Subtilisin-like
           seed-specific protein - Arachis hypogaea (Peanut),
           partial (19%)
          Length = 437

 Score = 97.6 bits (49), Expect = 9e-20
 Identities = 88/101 (87%)
 Strand = Plus / Minus

                                                                       
Query: 220 ggaacttctatgtcttgccctcatgttgctggcattgttggtcttctcaagacacttcat 279
           |||||||| ||| | ||||| |||||  |||||||||| || |||||| | |||||||||
Sbjct: 400 ggaacttccatggcatgcccccatgtatctggcattgtaggccttctccatacacttcat 341

                                                    
Query: 280 cctaaatggagtccagcagctatcaagtcagccatcatgac 320
           ||  ||||||||||||||||||||||||||||||| |||||
Sbjct: 340 ccagaatggagtccagcagctatcaagtcagccattatgac 300


>gnl|LJGI|TC63919 similar to UniRef100_A2Q1V2 Cluster: Peptidase S8 and S53,
           subtilisin, kexin, sedolisin; n=1; Medicago
           truncatula|Rep: Peptidase S8 and S53, subtilisin, kexin,
           sedolisin - Medicago truncatula (Barrel medic), partial
           (28%)
          Length = 861

 Score = 83.8 bits (42), Expect = 1e-15
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                       
Query: 394 tatggttcaggacatgtgcagcctaacctggcagtagaccctgggcttgtttatgatcta 453
           ||||||||||| ||||| || ||||||   ||| |||| |||||||||||||||||||||
Sbjct: 95  tatggttcagggcatgttcaacctaacagtgcaatagatcctgggcttgtttatgatcta 154

                                                 
Query: 454 agcataacagactacttgaacttcatatgtgcttctgg 491
           |||||    || |||||||||||| |||||||||||||
Sbjct: 155 agcattgttgattacttgaacttcttatgtgcttctgg 192