Miyakogusa Predicted Gene
- Lj2g3v2806680.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v2806680.1 tr|G7K283|G7K283_MEDTR Ferritin OS=Medicago
truncatula GN=MTR_5g083170 PE=2 SV=1,71.43,0,no
description,Ferritin-related; FERRITIN, PLANT,NULL; FERRITIN,Ferritin;
Ferritin-like,Ferritin/rib,CUFF.39315.1
(435 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC64989 similar to UniRef100_Q41709 Cluster: Ferritin-2... 815 0.0
gnl|LJGI|TC57335 homologue to UniRef100_Q948P6 Cluster: Ferritin... 182 1e-45
gnl|LJGI|TC68510 homologue to UniRef100_A5HKJ9 Cluster: Ferritin... 60 1e-08
>gnl|LJGI|TC64989 similar to UniRef100_Q41709 Cluster: Ferritin-2, chloroplast
precursor; n=1; Vigna unguiculata|Rep: Ferritin-2,
chloroplast precursor - Vigna unguiculata (Cowpea),
partial (83%)
Length = 1162
Score = 815 bits (411), Expect = 0.0
Identities = 411/411 (100%)
Strand = Plus / Plus
Query: 1 atgcttctcaaagccgctgttgctcttccttcttccaccttcaacgccgaccgttcgatt 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 88 atgcttctcaaagccgctgttgctcttccttcttccaccttcaacgccgaccgttcgatt 147
Query: 61 ccgtttcaccgccataacgcgaacaccgtggtggtttgcgccgccaccaaaggcgccagc 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 148 ccgtttcaccgccataacgcgaacaccgtggtggtttgcgccgccaccaaaggcgccagc 207
Query: 121 aacaaccgcgccctcaccggcgtgctgtttgagccgtttgaagaggtgaagaaggagctc 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 208 aacaaccgcgccctcaccggcgtgctgtttgagccgtttgaagaggtgaagaaggagctc 267
Query: 181 gatctcgttcctaccctccctcaatcctccctcgctcgccagaaataccatgacgattct 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 268 gatctcgttcctaccctccctcaatcctccctcgctcgccagaaataccatgacgattct 327
Query: 241 gaagctgcggttaacgaacaaatcaatgtggagtacaatgtctcatacgtttaccatgcg 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 328 gaagctgcggttaacgaacaaatcaatgtggagtacaatgtctcatacgtttaccatgcg 387
Query: 301 atgtatgcatacttcgatagggacaatgttgcgctcaagggtcttgctaacttttttcag 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 388 atgtatgcatacttcgatagggacaatgttgcgctcaagggtcttgctaacttttttcag 447
Query: 361 aaatcaagtgtagaggaaagagagcatgctgagaagttgatggaatatcag 411
|||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 448 aaatcaagtgtagaggaaagagagcatgctgagaagttgatggaatatcag 498
>gnl|LJGI|TC57335 homologue to UniRef100_Q948P6 Cluster: Ferritin-3, chloroplast
precursor; n=1; Glycine max|Rep: Ferritin-3, chloroplast
precursor - Glycine max (Soybean), partial (81%)
Length = 985
Score = 182 bits (92), Expect = 1e-45
Identities = 242/292 (82%)
Strand = Plus / Plus
Query: 120 caacaaccgcgccctcaccggcgtgctgtttgagccgtttgaagaggtgaagaaggagct 179
|||||||||| |||| |||||||| | ||||| || ||||||||||| |||||||||||
Sbjct: 162 caacaaccgccccctaaccggcgtcgtttttgaaccctttgaagaggtcaagaaggagct 221
Query: 180 cgatctcgttcctaccctccctcaatcctccctcgctcgccagaaataccatgacgattc 239
||| || ||||| || | |||||| | ||||| ||||||||||| | | || || |
Sbjct: 222 cgaccttgttcccactgttcctcaagcttcccttgctcgccagaagttcgtagatgagtg 281
Query: 240 tgaagctgcggttaacgaacaaatcaatgtggagtacaatgtctcatacgtttaccatgc 299
||| |||||| ||||||| || |||||||||||||||| ||| || || |||||||||||
Sbjct: 282 tgaggctgcgattaacgagcagatcaatgtggagtacactgtttcgtatgtttaccatgc 341
Query: 300 gatgtatgcatacttcgatagggacaatgttgcgctcaagggtcttgctaacttttttca 359
|||| ||| |||||||| ||||||||||||||||| ||||||||||| || ||||| |
Sbjct: 342 aatgtttgcctacttcgacagggacaatgttgcgcttaagggtcttgccaagtttttcaa 401
Query: 360 gaaatcaagtgtagaggaaagagagcatgctgagaagttgatggaatatcag 411
| | |||||| | |||||||| ||||||||||| || |||||||| ||||||
Sbjct: 402 ggagtcaagtatggaggaaagggagcatgctgaaaaattgatggagtatcag 453
>gnl|LJGI|TC68510 homologue to UniRef100_A5HKJ9 Cluster: Ferritin; n=1; Medicago
sativa subsp. falcata|Rep: Ferritin - Medicago falcata
(Sickle medic), partial (78%)
Length = 1103
Score = 60.0 bits (30), Expect = 1e-08
Identities = 87/106 (82%)
Strand = Plus / Plus
Query: 306 tgcatacttcgatagggacaatgttgcgctcaagggtcttgctaacttttttcagaaatc 365
|||||||||||| |||||||| | || |||||||| ||||| || || ||| || ||||
Sbjct: 430 tgcatacttcgacagggacaacatagccctcaaggggcttgccaagttctttaaggaatc 489
Query: 366 aagtgtagaggaaagagagcatgctgagaagttgatggaatatcag 411
||||| || ||||||| |||||| ||||| ||||| ||||||||
Sbjct: 490 aagtgatgaagaaagagggcatgcagagaaactgatgaaatatcag 535