Miyakogusa Predicted Gene

Lj2g3v2748700.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v2748700.1 tr|Q43443|Q43443_SOYBN Phosphoinositide-specific
phospholipase C P13 OS=Glycine max GN=Gma.6611 PE=2,91.3,2e-18,no
description,NULL; PHOSPHOINOSITIDE-SPECIFIC PHOSPHOLIPASE C FAMILY
PROTEIN,NULL;
PHOSPHOINOSITIDE,NODE_62731_length_477_cov_73.067085.path1.1
         (145 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC67497 similar to UniRef100_Q43439 Cluster: Phosphatid...   287   9e-78
gnl|LJGI|BG662228 homologue to UniRef100_Q93YX8 Cluster: Phospho...    76   6e-14

>gnl|LJGI|TC67497 similar to UniRef100_Q43439 Cluster: Phosphatidylinositol-specific
           phospholipase C; n=1; Glycine max|Rep:
           Phosphatidylinositol-specific phospholipase C - Glycine
           max (Soybean), partial (48%)
          Length = 1160

 Score =  287 bits (145), Expect = 9e-78
 Identities = 145/145 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtctgaaaaggatgactttggtgggcaaacatgcctaccagtgtgggagctaagaagt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 783 atgtctgaaaaggatgactttggtgggcaaacatgcctaccagtgtgggagctaagaagt 842

                                                                       
Query: 61  ggcattcgagcagttcccttgcacagccataagggagacaaatacaactctgtaaagctt 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 843 ggcattcgagcagttcccttgcacagccataagggagacaaatacaactctgtaaagctt 902

                                    
Query: 121 cttatgcgctttgaattttattgat 145
           |||||||||||||||||||||||||
Sbjct: 903 cttatgcgctttgaattttattgat 927


>gnl|LJGI|BG662228 homologue to UniRef100_Q93YX8 Cluster: Phosphoinositide-specific
           phospholipase C; n=1; Medicago truncatula|Rep:
           Phosphoinositide-specific phospholipase C - Medicago
           truncatula (Barrel medic), partial (19%)
          Length = 376

 Score = 75.8 bits (38), Expect = 6e-14
 Identities = 110/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtctgaaaaggatgactttggtgggcaaacatgcctaccagtgtgggagctaagaagt 60
           |||||||| |||||||||||||| |||||  ||||| |||| |||||||| ||||| || 
Sbjct: 208 atgtctgagaaggatgactttggagggcagtcatgcttacctgtgtgggaactaagtagc 267

                                                                       
Query: 61  ggcattcgagcagttcccttgcacagccataagggagacaaatacaactctgtaaagctt 120
           || ||||||||||||||  ||||   ||  || || ||||| ||||||  ||||| ||||
Sbjct: 268 ggaattcgagcagttccactgcattcccgcaaaggtgacaagtacaaccatgtaaggctt 327

                         
Query: 121 cttatgcgctttga 134
           || |||||||||||
Sbjct: 328 ctcatgcgctttga 341