Miyakogusa Predicted Gene

Lj2g3v2599890.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v2599890.1 tr|G8YHJ2|G8YHJ2_PICSO Piso0_003228 protein
OS=Pichia sorbitophila (strain ATCC MYA-4447 / BCRC
2208,30.3,0.0000000000001,no description,NULL; AAA,ATPase, AAA-type,
core; ATPases associated with a variety of cellula,AAA+ A,CUFF.39137.1
         (442 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC71647 weakly similar to UniRef100_Q5CKA3 Cluster: Cel...    74   8e-13

>gnl|LJGI|TC71647 weakly similar to UniRef100_Q5CKA3 Cluster: Cell division cycle
           protein 48; n=1; Cryptosporidium hominis|Rep: Cell
           division cycle protein 48 - Cryptosporidium hominis,
           partial (8%)
          Length = 736

 Score = 73.8 bits (37), Expect = 8e-13
 Identities = 40/41 (97%)
 Strand = Plus / Plus

                                                    
Query: 398 ttgatagggaaattggtattgatgctcttgatgaagctgga 438
           ||||||||||||||||||||| |||||||||||||||||||
Sbjct: 657 ttgatagggaaattggtattggtgctcttgatgaagctgga 697