Miyakogusa Predicted Gene

Lj2g3v2535450.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v2535450.1 Non Chatacterized Hit- tr|C5XC41|C5XC41_SORBI
Putative uncharacterized protein Sb02g024100
OS=Sorghu,47.66,5e-19,seg,NULL,CUFF.39053.1
         (627 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC76520 weakly similar to UniRef100_A7PZ23 Cluster: Chr...    52   4e-06

>gnl|LJGI|TC76520 weakly similar to UniRef100_A7PZ23 Cluster: Chromosome chr4
           scaffold_39, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr4 scaffold_39, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (52%)
          Length = 476

 Score = 52.0 bits (26), Expect = 4e-06
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 145 cctctcctcccggaagcttctagaaactcc 174
           |||||||| |||||||||||||||||||||
Sbjct: 292 cctctccttccggaagcttctagaaactcc 321