Miyakogusa Predicted Gene

Lj2g3v2449290.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v2449290.1 Non Chatacterized Hit- tr|G7ZYI1|G7ZYI1_MEDTR
Putative uncharacterized protein OS=Medicago
truncatul,45.1,0.19,seg,NULL,CUFF.38984.1
         (441 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AV425344 similar to UniRef100_Q805S1 Cluster: PTP2; n=1...    74   8e-13

>gnl|LJGI|AV425344 similar to UniRef100_Q805S1 Cluster: PTP2; n=1; Glyptapanteles
           indiensis bracovirus|Rep: PTP2 - Glyptapanteles
           indiensis, partial (4%)
          Length = 400

 Score = 73.8 bits (37), Expect = 8e-13
 Identities = 37/37 (100%)
 Strand = Plus / Plus

                                                
Query: 405 cacactcaaagatctgcaacttctcaatgttggaact 441
           |||||||||||||||||||||||||||||||||||||
Sbjct: 3   cacactcaaagatctgcaacttctcaatgttggaact 39