Miyakogusa Predicted Gene

Lj2g3v2256400.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v2256400.1 tr|G7JZH5|G7JZH5_MEDTR Phosphoinositide
phospholipase C OS=Medicago truncatula GN=MTR_5g071040 PE=4
,73.58,0,PLC-like phosphodiesterases,PLC-like phosphodiesterase, TIM
beta/alpha-barrel domain; C2 domain (Cal,CUFF.38780.1
         (1737 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC67497 similar to UniRef100_Q43439 Cluster: Phosphatid...    70   5e-11

>gnl|LJGI|TC67497 similar to UniRef100_Q43439 Cluster: Phosphatidylinositol-specific
            phospholipase C; n=1; Glycine max|Rep:
            Phosphatidylinositol-specific phospholipase C - Glycine
            max (Soybean), partial (48%)
          Length = 1160

 Score = 69.9 bits (35), Expect = 5e-11
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                           
Query: 1147 tggatgcatggagctcaaatggtagcatttaatatgcagggacatgg 1193
            ||||||||||||||||||||||| |||||||| |||||||| |||||
Sbjct: 354  tggatgcatggagctcaaatggttgcatttaacatgcaggggcatgg 400