Miyakogusa Predicted Gene

Lj2g3v2256320.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v2256320.1 Non Chatacterized Hit- tr|I1JHC6|I1JHC6_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.25141
PE,95.05,0,Na_Ca_ex,Sodium/calcium exchanger membrane region; FAMILY
NOT NAMED,NULL; seg,NULL,CUFF.38772.1
         (354 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC61254 similar to UniRef100_O64455 Cluster: Ca2+/H+ ex...    76   2e-13

>gnl|LJGI|TC61254 similar to UniRef100_O64455 Cluster: Ca2+/H+ exchanger; n=1; Vigna
           radiata var. radiata|Rep: Ca2+/H+ exchanger - Phaseolus
           aureus (Mung bean) (Vigna radiata), partial (37%)
          Length = 875

 Score = 75.8 bits (38), Expect = 2e-13
 Identities = 101/122 (82%)
 Strand = Plus / Plus

                                                                       
Query: 181 attgaggctgcatcagattcttggggaatttctgttagcttcattagtataattttgcta 240
           ||||||| |||||||||||| |||||  | | ||| || ||| | || ||||| ||||||
Sbjct: 111 attgaggatgcatcagattcatggggtctgtttgtaagtttcctcagcataatcttgcta 170

                                                                       
Query: 241 ccaattgttgggaatgctgcagaacatgctggttcaattatatttgcttttaagaacaag 300
           ||||| ||||| ||||| ||||||||||| ||  |||| || |||||||| |||||||||
Sbjct: 171 ccaatagttggcaatgcagcagaacatgcaggagcaatcatttttgctttcaagaacaag 230

             
Query: 301 ct 302
           ||
Sbjct: 231 ct 232