Miyakogusa Predicted Gene

Lj2g3v2195520.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v2195520.2 Non Chatacterized Hit- tr|I1JH75|I1JH75_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max
PE=4,73.98,0,DNA-binding domain of DNA mismatch repair MU,DNA mismatch
repair protein MutS, core; ATPase domain o,CUFF.38724.2
         (2367 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO011139 homologue to UniRef100_A7QET1 Cluster: Chromos...    92   2e-17

>gnl|LJGI|GO011139 homologue to UniRef100_A7QET1 Cluster: Chromosome chr16 scaffold_86
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:,
            partial (2%)
          Length = 641

 Score = 91.7 bits (46), Expect = 2e-17
 Identities = 49/50 (98%)
 Strand = Plus / Plus

                                                              
Query: 1684 gatgaagtgaacttgaagccaacttacaaggttctctggggcataccagg 1733
            ||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 342  gatgaagtgaatttgaagccaacttacaaggttctctggggcataccagg 391