Miyakogusa Predicted Gene

Lj2g3v2125080.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v2125080.1 Non Chatacterized Hit- tr|C0P490|C0P490_MAIZE
Uncharacterized protein OS=Zea mays PE=2 SV=1,56.41,0.74,
,NODE_76541_length_214_cov_120.892525.path2.1
         (152 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC80317 homologue to UniRef100_P30075 Cluster: Chalcone...   285   4e-77
gnl|LJGI|TC78733 homologue to UniRef100_P23569 Cluster: Chalcone...   238   8e-63
gnl|LJGI|TC69074 homologue to UniRef100_P23569 Cluster: Chalcone...   238   8e-63
gnl|LJGI|TC58268 homologue to UniRef100_A1E5T0 Cluster: Chalcone...   121   1e-27

>gnl|LJGI|TC80317 homologue to UniRef100_P30075 Cluster: Chalcone synthase 4; n=1;
           Medicago sativa|Rep: Chalcone synthase 4 - Medicago
           sativa (Alfalfa), complete
          Length = 1446

 Score =  285 bits (144), Expect = 4e-77
 Identities = 150/152 (98%)
 Strand = Plus / Minus

                                                                       
Query: 1   atggctccttcactatctggagcaatagtttgtgcagtccaaactagctcaaacaaaggt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 886 atggctccttcactatctggagcaatagtttgtgcagtccaaactagctcaaacaaaggt 827

                                                                       
Query: 61  ttctcaacttctggcactggatcggaaccaacaatgagtgcagctgctccgtctccgaac 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 826 ttctcaacttctggcactggatcggaaccaacaatgagtgcagctgctccgtctccgaac 767

                                           
Query: 121 aaagcttgcccaacaaggctgtctaggtgagt 152
           || |||||||| ||||||||||||||||||||
Sbjct: 766 aatgcttgcccgacaaggctgtctaggtgagt 735


>gnl|LJGI|TC78733 homologue to UniRef100_P23569 Cluster: Chalcone synthase; n=1;
           Pueraria montana var. lobata|Rep: Chalcone synthase -
           Pueraria lobata (Kudzu vine), complete
          Length = 1456

 Score =  238 bits (120), Expect = 8e-63
 Identities = 144/152 (94%)
 Strand = Plus / Minus

                                                                       
Query: 1   atggctccttcactatctggagcaatagtttgtgcagtccaaactagctcaaacaaaggt 60
           |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 917 atggctccgtcactatctggagcaatagtttgtgcagtccaaactagttcaaacaaaggt 858

                                                                       
Query: 61  ttctcaacttctggcactggatcggaaccaacaatgagtgcagctgctccgtctccgaac 120
           ||||||| ||| ||||||||||| |||||||||||||  |||||||||||||||||||||
Sbjct: 857 ttctcaatttcaggcactggatcagaaccaacaatgaccgcagctgctccgtctccgaac 798

                                           
Query: 121 aaagcttgcccaacaaggctgtctaggtgagt 152
           ||||||||||| ||||||||||||||||||||
Sbjct: 797 aaagcttgccccacaaggctgtctaggtgagt 766


>gnl|LJGI|TC69074 homologue to UniRef100_P23569 Cluster: Chalcone synthase; n=1;
           Pueraria montana var. lobata|Rep: Chalcone synthase -
           Pueraria lobata (Kudzu vine), complete
          Length = 1394

 Score =  238 bits (120), Expect = 8e-63
 Identities = 144/152 (94%)
 Strand = Plus / Minus

                                                                       
Query: 1   atggctccttcactatctggagcaatagtttgtgcagtccaaactagctcaaacaaaggt 60
           |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 834 atggctccgtcactatctggagcaatagtttgtgcagtccaaactagttcaaacaaaggt 775

                                                                       
Query: 61  ttctcaacttctggcactggatcggaaccaacaatgagtgcagctgctccgtctccgaac 120
           ||||||| ||| ||||||||||| |||||||||||||  |||||||||||||||||||||
Sbjct: 774 ttctcaatttcaggcactggatcagaaccaacaatgaccgcagctgctccgtctccgaac 715

                                           
Query: 121 aaagcttgcccaacaaggctgtctaggtgagt 152
           ||||||||||| ||||||||||||||||||||
Sbjct: 714 aaagcttgccccacaaggctgtctaggtgagt 683


>gnl|LJGI|TC58268 homologue to UniRef100_A1E5T0 Cluster: Chalcone synthase 4; n=1;
           Astragalus membranaceus var. mongholicus|Rep: Chalcone
           synthase 4 - Astragalus mongholicus (Huang qi)
           (Astragalus membranaceus var.mongholicus), partial (85%)
          Length = 826

 Score =  121 bits (61), Expect = 1e-27
 Identities = 73/77 (94%)
 Strand = Plus / Minus

                                                                       
Query: 76  actggatcggaaccaacaatgagtgcagctgctccgtctccgaacaaagcttgcccaaca 135
           |||||||||||||||||||||||||| |||||||| ||||| ||||| ||||||||||||
Sbjct: 823 actggatcggaaccaacaatgagtgcggctgctccatctccaaacaatgcttgcccaaca 764

                            
Query: 136 aggctgtctaggtgagt 152
           |||||||||||||||||
Sbjct: 763 aggctgtctaggtgagt 747