Miyakogusa Predicted Gene

Lj2g3v2088480.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v2088480.1 tr|G7J789|G7J789_MEDTR F-box protein SKIP19
OS=Medicago truncatula GN=MTR_3g080280 PE=4
SV=1,40.13,6e-19,Leucine-rich repeat - CC
(cysteine-containin,Leucine-rich repeat, cysteine-containing subtype;
N7-RE,gene.g42936.t1.1
         (804 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC63939 similar to UniRef100_Q2HSK3 Cluster: Cyclin-lik...    76   4e-13
gnl|LJGI|TC80874 weakly similar to UniRef100_O82023 Cluster: N7 ...    60   2e-08
gnl|LJGI|TC70271 weakly similar to UniRef100_Q2HSK3 Cluster: Cyc...    60   2e-08

>gnl|LJGI|TC63939 similar to UniRef100_Q2HSK3 Cluster: Cyclin-like F-box; n=1;
           Medicago truncatula|Rep: Cyclin-like F-box - Medicago
           truncatula (Barrel medic), partial (37%)
          Length = 840

 Score = 75.8 bits (38), Expect = 4e-13
 Identities = 158/198 (79%)
 Strand = Plus / Plus

                                                                       
Query: 535 tttgctatagcaaaaaccatgcctcaactacgtcatctacagatcatgggaatctatatc 594
           |||| ||||||| |||| |||||| | || ||||| |||||||| ||||||| |  | ||
Sbjct: 327 tttgttatagcagaaacaatgcctgagctgcgtcacctacagattatgggaaacagtctc 386

                                                                       
Query: 595 actaataatgctttgcttgccatcctcgatggttgtcctctacttgaatatcttgacctc 654
           | |||| |||  |||||||| || || |||||||| ||||| || |||||||||||||| 
Sbjct: 387 agtaatgatggcttgcttgctattcttgatggttgccctcttctcgaatatcttgaccta 446

                                                                       
Query: 655 cgagcttgtcatctgcttgatttgagtggaagtttggggaaaaagtgtcgtgagcggatt 714
           | || ||||| | |  ||||||||||||| |||||||  || | ||||| ||||| ||| 
Sbjct: 447 caaggttgtccttttgttgatttgagtggtagtttggaaaagaggtgtcatgagcagatc 506

                             
Query: 715 aaagttgtacggcttcca 732
           |||  | |||||||||||
Sbjct: 507 aaatatttacggcttcca 524



 Score = 58.0 bits (29), Expect = 9e-08
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 431 attttcttgaagcaattggccggtcttgccctcttttgaaaacattaaaattgaaca 487
           |||| |||||||| |||||| ||| ||| |||||||||||| |||||||| ||||||
Sbjct: 214 atttccttgaagctattggcaggtgttgtcctcttttgaaatcattaaaaatgaaca 270


>gnl|LJGI|TC80874 weakly similar to UniRef100_O82023 Cluster: N7 protein; n=1;
           Medicago truncatula|Rep: N7 protein - Medicago
           truncatula (Barrel medic), partial (34%)
          Length = 1017

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 523 gatgatgtggcatttgctatagcaaaaaccatgcctca 560
           ||||||| |||||||||||| |||||||||||||||||
Sbjct: 654 gatgatgaggcatttgctattgcaaaaaccatgcctca 691


>gnl|LJGI|TC70271 weakly similar to UniRef100_Q2HSK3 Cluster: Cyclin-like F-box; n=1;
           Medicago truncatula|Rep: Cyclin-like F-box - Medicago
           truncatula (Barrel medic), partial (28%)
          Length = 823

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 612 tgccatcctcgatggttgtcctctacttgaatatcttgacct 653
           |||||| || |||||||||||||| |||||||||||||||||
Sbjct: 384 tgccattcttgatggttgtcctcttcttgaatatcttgacct 425