Miyakogusa Predicted Gene

Lj2g3v2051010.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v2051010.1 Non Chatacterized Hit- tr|G7KC08|G7KC08_MEDTR
Putative uncharacterized protein OS=Medicago
truncatul,54.12,0.000000000000009,seg,NULL,CUFF.38465.1
         (423 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO012408 weakly similar to UniRef100_A9RVL3 Cluster: Pr...   135   2e-31

>gnl|LJGI|GO012408 weakly similar to UniRef100_A9RVL3 Cluster: Predicted protein; n=1;
           Physcomitrella patens subsp. patens|Rep: Predicted
           protein - Physcomitrella patens subsp. patens, partial
           (7%)
          Length = 624

 Score =  135 bits (68), Expect = 2e-31
 Identities = 99/107 (92%), Gaps = 3/107 (2%)
 Strand = Plus / Plus

                                                                       
Query: 313 ccaatagtttcctttagccggccgccaccgcttccaccggttataggaccattgcttgcc 372
           ||||||||||||||||||||||| ||| |  ||||||| ||||||||||| |||||||| 
Sbjct: 412 ccaatagtttcctttagccggcctccatc--ttccaccagttataggacccttgcttgct 469

                                                          
Query: 373 ctttcattgttggagacatggtggaacagcggttctgatgatgatgg 419
           ||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 470 ctttcattgttggagacat-gtggaacagcggttctgatgatgatgg 515