Miyakogusa Predicted Gene

Lj2g3v2028900.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v2028900.1 Non Chatacterized Hit- tr|B9T0V7|B9T0V7_RICCO
Indole-3-acetic acid-amido synthetase GH3.17,
putative,69.01,2e-19,GH3,GH3 auxin-responsive promoter; SUBFAMILY NOT
NAMED,NULL; FAMILY NOT NAMED,NULL,CUFF.38456.1
         (247 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC77138 similar to UniRef100_A7Q094 Cluster: Chromosome...    74   4e-13

>gnl|LJGI|TC77138 similar to UniRef100_A7Q094 Cluster: Chromosome chr7 scaffold_42,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr7 scaffold_42, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (19%)
          Length = 866

 Score = 73.8 bits (37), Expect = 4e-13
 Identities = 79/93 (84%)
 Strand = Plus / Plus

                                                                       
Query: 106 ataggaccacttgagatacgtgtagtggagacaggaacatttgaagcattgatggacttg 165
           ||||| |||||||||||||| || || ||| |||||||||||||  ||||| ||||||||
Sbjct: 209 atagggccacttgagatacgcgtggtagaggcaggaacatttgatacattgttggacttg 268

                                            
Query: 166 ttcattaaccaagggacttcaatcagtcagtac 198
           ||||||| || |||  ||||||||  |||||||
Sbjct: 269 ttcattagcctaggagcttcaatccatcagtac 301