Miyakogusa Predicted Gene
- Lj2g3v2017710.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v2017710.1 Non Chatacterized Hit- tr|I3SYY3|I3SYY3_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2 SV=1,98.94,0,MIP,Major
intrinsic protein; Aquaporin-like,Aquaporin-like; MIP,Major intrinsic
protein, conserved s,CUFF.38470.1
(855 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC67926 homologue to UniRef100_Q06Z30 Cluster: Aquapori... 1695 0.0
gnl|LJGI|TC80996 similar to UniRef100_Q06Z30 Cluster: Aquaporin ... 1001 0.0
gnl|LJGI|TC80088 homologue to UniRef100_Q946J9 Cluster: Aquapori... 220 1e-56
gnl|LJGI|TC74931 homologue to UniRef100_A0T2N6 Cluster: PIP1 pro... 200 1e-50
gnl|LJGI|TC71350 similar to UniRef100_A3F570 Cluster: Aquaporin;... 196 2e-49
gnl|LJGI|NP459447 GB|AF145708.1|AAD35016.1 plasma membrane intri... 194 6e-49
gnl|LJGI|TC67210 homologue to UniRef100_O22339 Cluster: Aquapori... 180 9e-45
gnl|LJGI|TC79489 similar to UniRef100_Q5DVT9 Cluster: Plasma mem... 176 1e-43
gnl|LJGI|TC71830 homologue to UniRef100_Q2HV44 Cluster: Major in... 174 6e-43
gnl|LJGI|TC72638 homologue to UniRef100_O65357 Cluster: Aquapori... 153 2e-36
gnl|LJGI|TC65853 homologue to UniRef100_Q9ATM4 Cluster: Aquapori... 115 5e-25
gnl|LJGI|TC78096 homologue to UniRef100_Q8W1A8 Cluster: Aquapori... 113 2e-24
gnl|LJGI|BW598844 homologue to UniRef100_O65357 Cluster: Aquapor... 105 4e-22
gnl|LJGI|BI420390 homologue to UniRef100_Q5U7L0 Cluster: Plasma ... 94 2e-18
gnl|LJGI|AV415328 homologue to UniRef100_Q946J9 Cluster: Aquapor... 64 2e-09
gnl|LJGI|DN652353 UniRef100_A3F571 Cluster: Aquaporin; n=1; Cucu... 60 2e-08
>gnl|LJGI|TC67926 homologue to UniRef100_Q06Z30 Cluster: Aquaporin 1; n=1; Gossypium
hirsutum|Rep: Aquaporin 1 - Gossypium hirsutum (Upland
cotton) (Gossypium mexicanum), partial (98%)
Length = 1615
Score = 1695 bits (855), Expect = 0.0
Identities = 855/855 (100%)
Strand = Plus / Plus
Query: 1 atggcttctgaagatgtgaaagttggagcaaacaaattctcagagaggcatgcattgggc 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 149 atggcttctgaagatgtgaaagttggagcaaacaaattctcagagaggcatgcattgggc 208
Query: 61 acagaagctcagggtgacaaggactacaaggagccacctccagcacccttgtttgagcca 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 209 acagaagctcagggtgacaaggactacaaggagccacctccagcacccttgtttgagcca 268
Query: 121 ggggagctgaagtcatggtcattttacagagctggaattgctgagtttgtagccaccttc 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 269 ggggagctgaagtcatggtcattttacagagctggaattgctgagtttgtagccaccttc 328
Query: 181 ttgttcctctacatcactgtcttaactgtcatgggtgtcaataggtcacccaacaagtgt 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 329 ttgttcctctacatcactgtcttaactgtcatgggtgtcaataggtcacccaacaagtgt 388
Query: 241 tcctctgttggcatccaaggtattgcttgggcttttggtggcatgatctttgcccttgtc 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 389 tcctctgttggcatccaaggtattgcttgggcttttggtggcatgatctttgcccttgtc 448
Query: 301 tactgcacagctggaatatcaggtgggcacattaatccggctgtgacgttcggtctgttt 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 449 tactgcacagctggaatatcaggtgggcacattaatccggctgtgacgttcggtctgttt 508
Query: 361 ttggcgaggaagctgtcgctcacccgagcgctgttctacattgtgatgcagtgccttgga 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 509 ttggcgaggaagctgtcgctcacccgagcgctgttctacattgtgatgcagtgccttgga 568
Query: 421 gctatctgcggtgctggtgtggtgaagggttttgagggcaatgctcgctttgagatgttc 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 569 gctatctgcggtgctggtgtggtgaagggttttgagggcaatgctcgctttgagatgttc 628
Query: 481 aaaggtggagcaaatgttgtgaatcctggatataccaagggtgatggccttggagctgag 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 629 aaaggtggagcaaatgttgtgaatcctggatataccaagggtgatggccttggagctgag 688
Query: 541 attgtcggtacctttgttcttgtctacactgtcttctctgccactgatgccaagagaaat 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 689 attgtcggtacctttgttcttgtctacactgtcttctctgccactgatgccaagagaaat 748
Query: 601 gccagagactctcatgttccgcttttggccccccttcccattggatttgctgtgttcttg 660
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 749 gccagagactctcatgttccgcttttggccccccttcccattggatttgctgtgttcttg 808
Query: 661 gtccacttggctaccattcccatcacaggaactggcattaacccagctaggagtcttggt 720
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 809 gtccacttggctaccattcccatcacaggaactggcattaacccagctaggagtcttggt 868
Query: 721 gctgccattatatacaacagagaccatgcttgggatgaccattggattttctgggttgga 780
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 869 gctgccattatatacaacagagaccatgcttgggatgaccattggattttctgggttgga 928
Query: 781 cctttcattggagctgctcttgctgctgtgtatcaccagatagtaatccgagcaattcct 840
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 929 cctttcattggagctgctcttgctgctgtgtatcaccagatagtaatccgagcaattcct 988
Query: 841 ttcaagacaaggggt 855
|||||||||||||||
Sbjct: 989 ttcaagacaaggggt 1003
>gnl|LJGI|TC80996 similar to UniRef100_Q06Z30 Cluster: Aquaporin 1; n=1; Gossypium
hirsutum|Rep: Aquaporin 1 - Gossypium hirsutum (Upland
cotton) (Gossypium mexicanum), complete
Length = 1192
Score = 1001 bits (505), Expect = 0.0
Identities = 762/847 (89%), Gaps = 3/847 (0%)
Strand = Plus / Plus
Query: 10 gaagatgtgaaagttggagcaaacaaattctcagagaggcatgcattgggcacagaagct 69
|||||||| || ||||||||||||||||||||||| || || |||| || |||| |||
Sbjct: 76 gaagatgttaaggttggagcaaacaaattctcagaaagacaaccattagggacagcagca 135
Query: 70 cagggtgacaa---ggactacaaggagccacctccagcacccttgtttgagccaggggag 126
||| ||||||| ||| |||||||||||||| ||||| || || |||||||||||||||
Sbjct: 136 cagagtgacaacaaggattacaaggagccacccccagctccattttttgagccaggggag 195
Query: 127 ctgaagtcatggtcattttacagagctggaattgctgagtttgtagccaccttcttgttc 186
|| ||||||||||| |||||||||||||| ||||||||||| |||||||||||||||||
Sbjct: 196 ctcaagtcatggtctttttacagagctggcattgctgagttcatagccaccttcttgttc 255
Query: 187 ctctacatcactgtcttaactgtcatgggtgtcaataggtcacccaacaagtgttcctct 246
|||||||| || |||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 256 ctctacattaccatcttaactgtcatgggtgtcaacaggtcacccaacaagtgttcctct 315
Query: 247 gttggcatccaaggtattgcttgggcttttggtggcatgatctttgcccttgtctactgc 306
|||||||| || || ||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 316 gttggcattcagggcattgcttggtcttttggtggcatgatctttgcccttgtctactgc 375
Query: 307 acagctggaatatcaggtgggcacattaatccggctgtgacgttcggtctgtttttggcg 366
|| |||||||| |||||||| ||||| || || |||||||| || ||||| ||| ||||
Sbjct: 376 actgctggaatttcaggtggacacataaacccagctgtgacctttggtctctttctggct 435
Query: 367 aggaagctgtcgctcacccgagcgctgttctacattgtgatgcagtgccttggagctatc 426
|||||||| || ||||| |||| |||||||||||||||||||| |||||||||||||||
Sbjct: 436 aggaagctctccctcacaagagcactgttctacattgtgatgcaatgccttggagctatc 495
Query: 427 tgcggtgctggtgtggtgaagggttttgagggcaatgctcgctttgagatgttcaaaggt 486
|| |||||||||||||||||||| |||||||| |||||| | | |||| |||||||||||
Sbjct: 496 tgtggtgctggtgtggtgaaggggtttgagggtaatgctaggtatgagttgttcaaaggt 555
Query: 487 ggagcaaatgttgtgaatcctggatataccaagggtgatggccttggagctgagattgtc 546
||||| ||| ||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 556 ggagctaattttgtgaatcctggatataccaagggtgatggacttggagctgagattgtt 615
Query: 547 ggtacctttgttcttgtctacactgtcttctctgccactgatgccaagagaaatgccaga 606
|| |||||||||||||||||||| || |||||||||||||||||||||||||| || |||
Sbjct: 616 ggcacctttgttcttgtctacaccgttttctctgccactgatgccaagagaaacgctaga 675
Query: 607 gactctcatgttccgcttttggccccccttcccattggatttgctgtgttcttggtccac 666
|||||||||||||| ||||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 676 gactctcatgttcctattttggctccccttcccattgggtttgctgtgttcttggtccac 735
Query: 667 ttggctaccattcccatcacaggaactggcattaacccagctaggagtcttggtgctgcc 726
||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 736 ttggccaccattcccatcacaggaactggaattaacccagctaggagtcttggagctgct 795
Query: 727 attatatacaacagagaccatgcttgggatgaccattggattttctgggttggacctttc 786
| || | |||||| ||| || ||||||| ||||||||||||||||||||||||||||
Sbjct: 796 ttaatcttcaacagggacttggcatgggatggccattggattttctgggttggacctttc 855
Query: 787 attggagctgctcttgctgctgtgtatcaccagatagtaatccgagcaattcctttcaag 846
||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 856 attggagctgcccttgctgctgtgtatcaccagatagtaatccgagccattcctttcaag 915
Query: 847 acaaggg 853
|||||||
Sbjct: 916 acaaggg 922
>gnl|LJGI|TC80088 homologue to UniRef100_Q946J9 Cluster: Aquaporin protein PIP1;1;
n=1; Medicago truncatula|Rep: Aquaporin protein PIP1;1 -
Medicago truncatula (Barrel medic), complete
Length = 1362
Score = 220 bits (111), Expect = 1e-56
Identities = 252/299 (84%)
Strand = Plus / Plus
Query: 505 cctggatataccaagggtgatggccttggagctgagattgtcggtacctttgttcttgtc 564
||||| || |||||||||||||| || || ||||||||||| || ||||||||||||||
Sbjct: 634 cctggttacaccaagggtgatggtctcggtgctgagattgttggcacctttgttcttgtt 693
Query: 565 tacactgtcttctctgccactgatgccaagagaaatgccagagactctcatgttccgctt 624
||||| |||||||| ||||| ||||| ||| | | |||||||||||||| || || ||
Sbjct: 694 tacaccgtcttctccgccaccgatgctaagcgtagcgccagagactctcacgtccccatt 753
Query: 625 ttggccccccttcccattggatttgctgtgttcttggtccacttggctaccattcccatc 684
||||| || || || ||||| || |||||||||||||| || ||||||||||| |||||
Sbjct: 754 ttggcacctctgcctattgggttcgctgtgttcttggtgcatttggctaccatccccatt 813
Query: 685 acaggaactggcattaacccagctaggagtcttggtgctgccattatatacaacagagac 744
||||||||||| || ||||| ||||||||||| |||||||||||||| | ||||| |||
Sbjct: 814 acaggaactggtatcaaccctgctaggagtctcggtgctgccattatcttcaacaaggac 873
Query: 745 catgcttgggatgaccattggattttctgggttggacctttcattggagctgctcttgc 803
| || |||||||| || ||||| |||||||| ||||| ||||| ||||||||||||||
Sbjct: 874 cgtggctgggatgatcactggatcttctgggtgggaccattcatcggagctgctcttgc 932
Score = 145 bits (73), Expect = 5e-34
Identities = 304/381 (79%)
Strand = Plus / Plus
Query: 78 caaggactacaaggagccacctccagcacccttgtttgagccaggggagctgaagtcatg 137
|||||||||| |||||||||| || || || |||||||||| |||||| | |||||
Sbjct: 207 caaggactaccaggagccaccacctgcgccgctgtttgagccgtcggagctcacctcatg 266
Query: 138 gtcattttacagagctggaattgctgagtttgtagccaccttcttgttcctctacatcac 197
||| || |||||||| || ||||| |||||||| |||||||| ||||||||||||||||
Sbjct: 267 gtccttctacagagccggtattgccgagtttgttgccacctttctgttcctctacatcac 326
Query: 198 tgtcttaactgtcatgggtgtcaataggtcacccaacaagtgttcctctgttggcatcca 257
||||| || ||||||||||||| | | | |||||| ||||||| || ||
Sbjct: 327 cgtcttgaccgtcatgggtgtcagcggtgccgatagcaagtgcaaaactgttggtattca 386
Query: 258 aggtattgcttgggcttttggtggcatgatctttgcccttgtctactgcacagctggaat 317
||| |||||||||||||| |||||||||||||| || || || |||||||| || |||||
Sbjct: 387 agggattgcttgggctttcggtggcatgatcttcgctctcgtttactgcaccgccggaat 446
Query: 318 atcaggtgggcacattaatccggctgtgacgttcggtctgtttttggcgaggaagctgtc 377
||||| || ||||| || ||||||||||| || || |||||||||||||||||| ||||
Sbjct: 447 ctcaggaggtcacataaacccggctgtgacttttgggctgtttttggcgaggaagttgtc 506
Query: 378 gctcacccgagcgctgttctacattgtgatgcagtgccttggagctatctgcggtgctgg 437
| || | || | |||||||| |||||||||||||| || ||||| || || ||
Sbjct: 507 cttgacaagggctattttctacatcgtgatgcagtgcctgggtgctattgttggcgccgg 566
Query: 438 tgtggtgaagggttttgaggg 458
|||||||| |||||||||||
Sbjct: 567 cgtggtgaaaggttttgaggg 587
>gnl|LJGI|TC74931 homologue to UniRef100_A0T2N6 Cluster: PIP1 protein; n=1; Gossypium
hirsutum|Rep: PIP1 protein - Gossypium hirsutum (Upland
cotton) (Gossypium mexicanum), partial (38%)
Length = 805
Score = 200 bits (101), Expect = 1e-50
Identities = 227/269 (84%)
Strand = Plus / Plus
Query: 535 gctgagattgtcggtacctttgttcttgtctacactgtcttctctgccactgatgccaag 594
||||||||||| || |||||||||||||| ||||| |||||||| ||||| ||||| |||
Sbjct: 10 gctgagattgttggcacctttgttcttgtttacaccgtcttctccgccaccgatgctaag 69
Query: 595 agaaatgccagagactctcatgttccgcttttggccccccttcccattggatttgctgtg 654
| | |||||||||||||| || || ||||||| || || || ||||| || ||||||
Sbjct: 70 cgtagcgccagagactctcacgtccccattttggcacctctgcctattgggttcgctgtg 129
Query: 655 ttcttggtccacttggctaccattcccatcacaggaactggcattaacccagctaggagt 714
|||||||| || ||||||||||| ||||| ||||||||||| || ||||| |||||||||
Sbjct: 130 ttcttggtgcatttggctaccatccccattacaggaactggtatcaaccctgctaggagt 189
Query: 715 cttggtgctgccattatatacaacagagaccatgcttgggatgaccattggattttctgg 774
|| |||||||||||||| | ||||| |||| || |||||||| || ||||| ||||||
Sbjct: 190 ctcggtgctgccattatcttcaacaaggaccgtggctgggatgatcactggatcttctgg 249
Query: 775 gttggacctttcattggagctgctcttgc 803
|| ||||| ||||| ||||||||||||||
Sbjct: 250 gtgggaccattcatcggagctgctcttgc 278
>gnl|LJGI|TC71350 similar to UniRef100_A3F570 Cluster: Aquaporin; n=1; Cucumis
sativus|Rep: Aquaporin - Cucumis sativus (Cucumber),
partial (97%)
Length = 1168
Score = 196 bits (99), Expect = 2e-49
Identities = 270/327 (82%)
Strand = Plus / Plus
Query: 520 ggtgatggccttggagctgagattgtcggtacctttgttcttgtctacactgtcttctct 579
||||||||||||||||| |||||||| || || ||||| ||||| |||||||| ||||||
Sbjct: 611 ggtgatggccttggagcagagattgttggcacatttgtgcttgtttacactgtgttctct 670
Query: 580 gccactgatgccaagagaaatgccagagactctcatgttccgcttttggccccccttccc 639
|| |||||||||||| |||| || ||||||| || |||| ||||||| || || |||
Sbjct: 671 gctactgatgccaagcgaaacgcacgagactcgcacattcctattttggcaccactaccc 730
Query: 640 attggatttgctgtgttcttggtccacttggctaccattcccatcacaggaactggcatt 699
||||| ||||||||||| |||| || |||||||| ||||||||||| |||||||| ||
Sbjct: 731 attggttttgctgtgtttctggtgcatttggctacaattcccatcactggaactggtatc 790
Query: 700 aacccagctaggagtcttggtgctgccattatatacaacagagaccatgcttgggatgac 759
||||| || || ||||| ||||| ||| |||| | ||||| ||||| || |||||||||
Sbjct: 791 aaccctgccagaagtctaggtgcagcccttattttcaacaaggaccaagcgtgggatgac 850
Query: 760 cattggattttctgggttggacctttcattggagctgctcttgctgctgtgtatcaccag 819
|||||||| || ||||| || || |||||||| || || ||||| ||| ||||||| |||
Sbjct: 851 cattggatattttgggtagggccattcattggggcagcacttgcagctctgtatcatcag 910
Query: 820 atagtaatccgagcaattcctttcaag 846
||||| ||| | || ||||| ||||||
Sbjct: 911 atagtgatcagggccattcccttcaag 937
Score = 95.6 bits (48), Expect = 4e-19
Identities = 225/284 (79%)
Strand = Plus / Plus
Query: 82 gactacaaggagccacctccagcacccttgtttgagccaggggagctgaagtcatggtca 141
|||||||| ||||| || ||||||| || || ||||| || |||||| ||||||||
Sbjct: 176 gactacaaagagcctccctcagcacctttcttcgagcccggcgagctgtcatcatggtcc 235
Query: 142 ttttacagagctggaattgctgagtttgtagccaccttcttgttcctctacatcactgtc 201
|| |||||||| || || || ||||| || ||||| |||||||| || |||||||| ||
Sbjct: 236 ttctacagagccggcatagcagagttcgtcgccacgttcttgtttctttacatcaccgtg 295
Query: 202 ttaactgtcatgggtgtcaataggtcacccaacaagtgttcctctgttggcatccaaggt 261
|||||||| |||||||| || || | |||||||||| ||||||| |||||||
Sbjct: 296 ttaactgtgatgggtgtggctaaatccaagagcaagtgttccactgttggtgtccaaggc 355
Query: 262 attgcttgggcttttggtggcatgatctttgcccttgtctactgcacagctggaatatca 321
|| |||||| | |||||||| ||||||||||| |||||||| ||||| ||||| || |||
Sbjct: 356 atagcttggtcatttggtggaatgatctttgctcttgtctattgcactgctggcatctca 415
Query: 322 ggtgggcacattaatccggctgtgacgttcggtctgtttttggc 365
|| || ||||| || || || ||||| || || ||||| |||||
Sbjct: 416 gggggtcacataaacccagcagtgacatttgggctgttcttggc 459
>gnl|LJGI|NP459447 GB|AF145708.1|AAD35016.1 plasma membrane intrinsic protein homolog
[Lotus japonicus]
Length = 578
Score = 194 bits (98), Expect = 6e-49
Identities = 251/302 (83%)
Strand = Plus / Plus
Query: 148 agagctggaattgctgagtttgtagccaccttcttgttcctctacatcactgtcttaact 207
|||||||| |||||||||||| |||| || || |||||||| ||||||||||| || |||
Sbjct: 64 agagctgggattgctgagtttatagctacgtttttgttcctgtacatcactgttttgact 123
Query: 208 gtcatgggtgtcaataggtcacccaacaagtgttcctctgttggcatccaaggtattgct 267
|| |||||||| || |||||||| |||| |||| | || || || ||||||||||| |||
Sbjct: 124 gttatgggtgtgaagaggtcaccgaacatgtgtgcttccgtcggaatccaaggtatcgct 183
Query: 268 tgggcttttggtggcatgatctttgcccttgtctactgcacagctggaatatcaggtggg 327
|||||||| ||||| |||||||| || || ||||||||||| ||||| || || |||||
Sbjct: 184 tgggctttcggtggtatgatcttcgctctcgtctactgcaccgctggtatctccggtgga 243
Query: 328 cacattaatccggctgtgacgttcggtctgtttttggcgaggaagctgtcgctcacccga 387
||||| || || || || ||||||||| | || || || |||||||| |||||||| |||
Sbjct: 244 cacatcaacccagcggttacgttcggtttattcttagctaggaagctttcgctcacacga 303
Query: 388 gcgctgttctacattgtgatgcagtgccttggagctatctgcggtgctggtgtggtgaag 447
|| ||| |||||| |||||||||||| | ||||||||||| || || |||||||| |||
Sbjct: 304 gctgtgtactacatagtgatgcagtgcttaggagctatctgtggagcgggtgtggtcaag 363
Query: 448 gg 449
||
Sbjct: 364 gg 365
Score = 107 bits (54), Expect = 1e-22
Identities = 114/134 (85%)
Strand = Plus / Plus
Query: 529 cttggagctgagattgtcggtacctttgttcttgtctacactgtcttctctgccactgat 588
||||||||||||||| | || |||||||| ||||| ||||| ||||||||||||||||||
Sbjct: 442 cttggagctgagattattggaacctttgtccttgtttacaccgtcttctctgccactgat 501
Query: 589 gccaagagaaatgccagagactctcatgttccgcttttggccccccttcccattggattt 648
||||||||||| || | |||||||||||||| || | || || || || || |||||
Sbjct: 502 gccaagagaaacgctcgtgactctcatgttcctattctagcaccgctccctatcggattc 561
Query: 649 gctgtgttcttggt 662
||||||||||||||
Sbjct: 562 gctgtgttcttggt 575
>gnl|LJGI|TC67210 homologue to UniRef100_O22339 Cluster: Aquaporin-like transmembrane
channel protein; n=1; Medicago sativa|Rep:
Aquaporin-like transmembrane channel protein - Medicago
sativa (Alfalfa), complete
Length = 1162
Score = 180 bits (91), Expect = 9e-45
Identities = 247/299 (82%)
Strand = Plus / Plus
Query: 505 cctggatataccaagggtgatggccttggagctgagattgtcggtacctttgttcttgtc 564
||||| || ||||| ||||| ||||| || ||||||||||| || ||||| |||||||||
Sbjct: 577 cctggctacaccaaaggtgacggcctcggtgctgagattgttggcaccttcgttcttgtc 636
Query: 565 tacactgtcttctctgccactgatgccaagagaaatgccagagactctcatgttccgctt 624
||||| |||||||| ||||| ||||||||| | |||||||||||||| ||||| ||
Sbjct: 637 tacaccgtcttctcagccacggatgccaagcgttccgccagagactctcacgttccaatt 696
Query: 625 ttggccccccttcccattggatttgctgtgttcttggtccacttggctaccattcccatc 684
||||| || | || ||||| || || ||||||||||| |||||||| ||||| || |||
Sbjct: 697 ttggcaccattgccaattgggttcgcggtgttcttggtacacttggcaaccatcccaatc 756
Query: 685 acaggaactggcattaacccagctaggagtcttggtgctgccattatatacaacagagac 744
|| ||||| || || ||||| ||| ||||||| || ||| |||| | | |||| ||||
Sbjct: 757 accggaaccggtatcaaccctgctcggagtctcggcgcttccatagtctttaacaaagac 816
Query: 745 catgcttgggatgaccattggattttctgggttggacctttcattggagctgctcttgc 803
| || ||||||||||| |||||||||||||||||||||||||||||||| ||||||||
Sbjct: 817 cttggctgggatgaccactggattttctgggttggacctttcattggagcagctcttgc 875
Score = 123 bits (62), Expect = 2e-27
Identities = 176/214 (82%)
Strand = Plus / Plus
Query: 245 ctgttggcatccaaggtattgcttgggcttttggtggcatgatctttgcccttgtctact 304
||||||| || ||||| ||||||||||||||||||||||||||||| || || || ||||
Sbjct: 316 ctgttgggattcaaggaattgcttgggcttttggtggcatgatcttcgcactcgtttact 375
Query: 305 gcacagctggaatatcaggtgggcacattaatccggctgtgacgttcggtctgtttttgg 364
|||| |||||||| || || || ||||| || || || ||||| || |||||||| ||||
Sbjct: 376 gcactgctggaatctctgggggtcacataaacccagcggtgacatttggtctgttcttgg 435
Query: 365 cgaggaagctgtcgctcacccgagcgctgttctacattgtgatgcagtgccttggagcta 424
| ||||| |||| | || | ||| |||||||||| ||||||||| || || ||||
Sbjct: 436 caaggaaattgtcattgacaagggcggtgttctacatggtgatgcaggtgctaggtgcta 495
Query: 425 tctgcggtgctggtgtggtgaagggttttgaggg 458
| ||||| |||||||||||||||||||| |||||
Sbjct: 496 tatgcggcgctggtgtggtgaagggtttcgaggg 529
>gnl|LJGI|TC79489 similar to UniRef100_Q5DVT9 Cluster: Plasma membrane intrinsic
protein 2;1; n=1; Mimosa pudica|Rep: Plasma membrane
intrinsic protein 2;1 - Mimosa pudica (Sensitive plant),
partial (95%)
Length = 1169
Score = 176 bits (89), Expect = 1e-43
Identities = 218/261 (83%)
Strand = Plus / Plus
Query: 535 gctgagattgtcggtacctttgttcttgtctacactgtcttctctgccactgatgccaag 594
||||||||| | || ||||| ||||||||||||||||| ||||||||||||||| | |||
Sbjct: 558 gctgagattattggcaccttcgttcttgtctacactgttttctctgccactgatcctaag 617
Query: 595 agaaatgccagagactctcatgttccgcttttggccccccttcccattggatttgctgtg 654
||||| || || || || |||||||| ||||||| || ||||| |||||||||||||||
Sbjct: 618 agaaacgctagggattcccatgttcctgttttggctccacttcctattggatttgctgtg 677
Query: 655 ttcttggtccacttggctaccattcccatcacaggaactggcattaacccagctaggagt 714
||| |||| ||||||||||| || || | || || ||||| ||||||||||| ||||||
Sbjct: 678 ttcatggttcacttggctacaatccctgttactggtactggaattaacccagcaaggagt 737
Query: 715 cttggtgctgccattatatacaacagagaccatgcttgggatgaccattggattttctgg 774
|||| ||||| | || |||||| |||| | ||||||||||||||||||||||||
Sbjct: 738 tttggagctgctgtcatctacaacgaagacaaaatctgggatgaccattggattttctgg 797
Query: 775 gttggacctttcattggagct 795
|||||||| || |||||||||
Sbjct: 798 gttggaccatttattggagct 818
Score = 60.0 bits (30), Expect = 2e-08
Identities = 45/50 (90%)
Strand = Plus / Plus
Query: 259 ggtattgcttgggcttttggtggcatgatctttgcccttgtctactgcac 308
|||||||||||||| ||||||||||||||||| |||||| ||||||||
Sbjct: 286 ggtattgcttgggcctttggtggcatgatcttcatccttgtttactgcac 335
>gnl|LJGI|TC71830 homologue to UniRef100_Q2HV44 Cluster: Major intrinsic protein;
n=1; Medicago truncatula|Rep: Major intrinsic protein -
Medicago truncatula (Barrel medic), partial (97%)
Length = 1178
Score = 174 bits (88), Expect = 6e-43
Identities = 226/272 (83%)
Strand = Plus / Plus
Query: 535 gctgagattgtcggtacctttgttcttgtctacactgtcttctctgccactgatgccaag 594
||||||||| |||| |||||||| ||||||||||| |||||||| ||||| ||| |||||
Sbjct: 585 gctgagattatcggcacctttgtccttgtctacaccgtcttctccgccaccgatcccaag 644
Query: 595 agaaatgccagagactctcatgttccgcttttggccccccttcccattggatttgctgtg 654
||||| |||||||| || |||||||| ||||||| || ||||| ||||| ||||| |||
Sbjct: 645 agaaacgccagagattcccatgttcctgttttggcacctcttccaattgggtttgcagtg 704
Query: 655 ttcttggtccacttggctaccattcccatcacaggaactggcattaacccagctaggagt 714
||| |||| |||||||| ||||| |||||||| ||||| || || ||||| ||||| ||
Sbjct: 705 ttcatggttcacttggccaccatccccatcactggaaccggaatcaaccctgctagaagc 764
Query: 715 cttggtgctgccattatatacaacagagaccatgcttgggatgaccattggattttctgg 774
| || ||||| | |||||||||| || | || ||||||||||| ||||| ||||||
Sbjct: 765 ttcggagctgctgtcatatacaacaacgagaaggcatgggatgaccagtggatcttctgg 824
Query: 775 gttggacctttcattggagctgctcttgctgc 806
|| |||||||||||||| ||| || |||||||
Sbjct: 825 gtgggacctttcattggtgctactattgctgc 856
Score = 52.0 bits (26), Expect = 6e-06
Identities = 101/126 (80%)
Strand = Plus / Plus
Query: 247 gttggcatccaaggtattgcttgggcttttggtggcatgatctttgcccttgtctactgc 306
|||||||||| || || |||||||| || || |||||||| || ||| || ||||||
Sbjct: 300 gttggcatcctcggcatcgcttgggccttcggcggcatgattttcatcctcgtttactgc 359
Query: 307 acagctggaatatcaggtgggcacattaatccggctgtgacgttcggtctgtttttggcg 366
|| || || || ||||| || ||||| || ||||| |||||||||||| |||| |||||
Sbjct: 360 accgccggcatctcagggggtcacataaacccggcggtgacgttcggtttgttcctggcg 419
Query: 367 aggaag 372
||||||
Sbjct: 420 aggaag 425
>gnl|LJGI|TC72638 homologue to UniRef100_O65357 Cluster: Aquaporin 2; n=1; Samanea
saman|Rep: Aquaporin 2 - Samanea saman (Rain tree),
complete
Length = 1276
Score = 153 bits (77), Expect = 2e-36
Identities = 203/245 (82%)
Strand = Plus / Plus
Query: 547 ggtacctttgttcttgtctacactgtcttctctgccactgatgccaagagaaatgccaga 606
|||||||||||| | || ||||| || |||||||| |||||| |||| |||| |||||||
Sbjct: 632 ggtacctttgttttggtatacacagtgttctctgctactgatcccaaaagaagtgccaga 691
Query: 607 gactctcatgttccgcttttggccccccttcccattggatttgctgtgttcttggtccac 666
|| || ||||| ||| ||||||| || |||||||||||||||||||||||| |||| |||
Sbjct: 692 gattcccatgtgccggttttggctccacttcccattggatttgctgtgttcatggttcac 751
Query: 667 ttggctaccattcccatcacaggaactggcattaacccagctaggagtcttggtgctgcc 726
||||| ||||| || |||| || |||||||||||||| ||||||||| |||| |||||
Sbjct: 752 ttggccaccatcccagtcactggtactggcattaaccctgctaggagttttggagctgct 811
Query: 727 attatatacaacagagaccatgcttgggatgaccattggattttctgggttggacctttc 786
|||| | |||| | | | ||||||||||||||||| |||||||| ||||| |||
Sbjct: 812 gttatcttcaaccaatctaaaccctgggatgaccattggatcttctgggtaggaccattc 871
Query: 787 attgg 791
|||||
Sbjct: 872 attgg 876
Score = 79.8 bits (40), Expect = 3e-14
Identities = 100/120 (83%)
Strand = Plus / Plus
Query: 246 tgttggcatccaaggtattgcttgggcttttggtggcatgatctttgcccttgtctactg 305
||||||||| | |||||||||||||| ||||||||||||||||| |||||| |||||
Sbjct: 334 tgttggcattcttggtattgcttgggcctttggtggcatgatcttcatccttgtttactg 393
Query: 306 cacagctggaatatcaggtgggcacattaatccggctgtgacgttcggtctgtttttggc 365
||| ||||| || ||||| || |||||||| || || ||||| || || ||||| |||||
Sbjct: 394 caccgctgggatctcagggggtcacattaacccagcagtgacatttgggctgttcttggc 453
>gnl|LJGI|TC65853 homologue to UniRef100_Q9ATM4 Cluster: Aquaporin PIP2-7; n=1; Zea
mays|Rep: Aquaporin PIP2-7 - Zea mays (Maize), complete
Length = 1346
Score = 115 bits (58), Expect = 5e-25
Identities = 142/170 (83%)
Strand = Plus / Plus
Query: 550 acctttgttcttgtctacactgtcttctctgccactgatgccaagagaaatgccagagac 609
||||||||||||||||||||||| |||||||| |||||| | ||||| || || || ||
Sbjct: 706 acctttgttcttgtctacactgttttctctgctactgatcctaagaggaacgctagggat 765
Query: 610 tctcatgttccgcttttggccccccttcccattggatttgctgtgttcttggtccacttg 669
|| |||||||| | |||| || ||||| |||||||||||||||||| |||| ||||||
Sbjct: 766 tcccatgttcctgtactggcaccacttccaattggatttgctgtgttcatggttcacttg 825
Query: 670 gctaccattcccatcacaggaactggcattaacccagctaggagtcttgg 719
||||| || || | || || ||||||||||||||||| |||||| ||||
Sbjct: 826 gctacaatccctgttactggcactggcattaacccagcaaggagttttgg 875
Score = 73.8 bits (37), Expect = 2e-12
Identities = 76/89 (85%)
Strand = Plus / Plus
Query: 259 ggtattgcttgggcttttggtggcatgatctttgcccttgtctactgcacagctggaata 318
||||| |||||||| ||||||||||||||||| | |||||| |||||||| || || ||
Sbjct: 418 ggtatagcttgggcctttggtggcatgatcttcgtccttgtttactgcaccgccggtatc 477
Query: 319 tcaggtgggcacattaatccggctgtgac 347
||||| ||||| ||||| || ||||||||
Sbjct: 478 tcaggagggcatattaaccctgctgtgac 506
>gnl|LJGI|TC78096 homologue to UniRef100_Q8W1A8 Cluster: Aquaporin-like protein; n=1;
Petunia x hybrida|Rep: Aquaporin-like protein - Petunia
hybrida (Petunia), partial (30%)
Length = 800
Score = 113 bits (57), Expect = 2e-24
Identities = 144/173 (83%)
Strand = Plus / Plus
Query: 623 ttttggccccccttcccattggatttgctgtgttcttggtccacttggctaccattccca 682
||||||| || ||||| |||||||||||||||||| |||| ||||||||||| || ||
Sbjct: 6 ttttggctccacttcctattggatttgctgtgttcatggttcacttggctacaatccctg 65
Query: 683 tcacaggaactggcattaacccagctaggagtcttggtgctgccattatatacaacagag 742
| || || ||||| ||||||||||| |||||| |||| ||||| | || |||||| ||
Sbjct: 66 ttactggtactggaattaacccagcaaggagttttggagctgctgtcatctacaacgaag 125
Query: 743 accatgcttgggatgaccattggattttctgggttggacctttcattggagct 795
|| | |||||||||||||||||||||||||||||||| || |||||||||
Sbjct: 126 acaaaatctgggatgaccattggattttctgggttggaccatttattggagct 178
>gnl|LJGI|BW598844 homologue to UniRef100_O65357 Cluster: Aquaporin 2; n=1; Samanea
saman|Rep: Aquaporin 2 - Samanea saman (Rain tree),
partial (31%)
Length = 479
Score = 105 bits (53), Expect = 4e-22
Identities = 140/169 (82%)
Strand = Plus / Plus
Query: 623 ttttggccccccttcccattggatttgctgtgttcttggtccacttggctaccattccca 682
||||||| || |||||||||||||||||||||||| |||| |||||||| ||||| ||
Sbjct: 80 ttttggctccacttcccattggatttgctgtgttcatggttcacttggccaccatcccag 139
Query: 683 tcacaggaactggcattaacccagctaggagtcttggtgctgccattatatacaacagag 742
|||| || |||||||||||||| ||||||||| |||| ||||| |||| | |||| |
Sbjct: 140 tcactggtactggcattaaccctgctaggagttttggagctgctgttatcttcaaccaat 199
Query: 743 accatgcttgggatgaccattggattttctgggttggacctttcattgg 791
| | ||||||||||||||||| |||||||| ||||| ||||||||
Sbjct: 200 ctaagccctgggatgaccattggatcttctgggtaggaccattcattgg 248
>gnl|LJGI|BI420390 homologue to UniRef100_Q5U7L0 Cluster: Plasma membrane intrinsic
protein; n=1; Glycyrrhiza uralensis|Rep: Plasma membrane
intrinsic protein - Glycyrrhiza uralensis, partial (51%)
Length = 493
Score = 93.7 bits (47), Expect = 2e-18
Identities = 107/127 (84%)
Strand = Plus / Plus
Query: 245 ctgttggcatccaaggtattgcttgggcttttggtggcatgatctttgcccttgtctact 304
||||||| || ||||| ||||||||||||||||||||||||||||| || || || ||||
Sbjct: 299 ctgttgggattcaaggaattgcttgggcttttggtggcatgatcttcgcactcgtttact 358
Query: 305 gcacagctggaatatcaggtgggcacattaatccggctgtgacgttcggtctgtttttgg 364
|||| |||||||| || || || ||||| || || || ||||| || |||||||| ||||
Sbjct: 359 gcactgctggaatctctgggggtcacataaacccagcggtgacatttggtctgttcttgg 418
Query: 365 cgaggaa 371
| |||||
Sbjct: 419 caaggaa 425
>gnl|LJGI|AV415328 homologue to UniRef100_Q946J9 Cluster: Aquaporin protein PIP1;1;
n=1; Medicago truncatula|Rep: Aquaporin protein PIP1;1 -
Medicago truncatula (Barrel medic), partial (27%)
Length = 264
Score = 63.9 bits (32), Expect = 2e-09
Identities = 50/56 (89%)
Strand = Plus / Plus
Query: 165 gtttgtagccaccttcttgttcctctacatcactgtcttaactgtcatgggtgtca 220
|||||| |||||||| |||||||||||||||| ||||| || |||||||||||||
Sbjct: 154 gtttgttgccacctttctgttcctctacatcaccgtcttgaccgtcatgggtgtca 209
>gnl|LJGI|DN652353 UniRef100_A3F571 Cluster: Aquaporin; n=1; Cucurbita ficifolia|Rep:
Aquaporin - Cucurbita ficifolia (figleaf gourd), partial
(6%)
Length = 255
Score = 60.0 bits (30), Expect = 2e-08
Identities = 45/50 (90%)
Strand = Plus / Plus
Query: 259 ggtattgcttgggcttttggtggcatgatctttgcccttgtctactgcac 308
||||| |||||||| ||||||||||||||||| | |||||| ||||||||
Sbjct: 206 ggtatagcttgggcctttggtggcatgatcttcgtccttgtttactgcac 255