Miyakogusa Predicted Gene

Lj2g3v2017710.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v2017710.1 Non Chatacterized Hit- tr|I3SYY3|I3SYY3_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2 SV=1,98.94,0,MIP,Major
intrinsic protein; Aquaporin-like,Aquaporin-like; MIP,Major intrinsic
protein, conserved s,CUFF.38470.1
         (855 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC67926 homologue to UniRef100_Q06Z30 Cluster: Aquapori...  1695   0.0  
gnl|LJGI|TC80996 similar to UniRef100_Q06Z30 Cluster: Aquaporin ...  1001   0.0  
gnl|LJGI|TC80088 homologue to UniRef100_Q946J9 Cluster: Aquapori...   220   1e-56
gnl|LJGI|TC74931 homologue to UniRef100_A0T2N6 Cluster: PIP1 pro...   200   1e-50
gnl|LJGI|TC71350 similar to UniRef100_A3F570 Cluster: Aquaporin;...   196   2e-49
gnl|LJGI|NP459447 GB|AF145708.1|AAD35016.1 plasma membrane intri...   194   6e-49
gnl|LJGI|TC67210 homologue to UniRef100_O22339 Cluster: Aquapori...   180   9e-45
gnl|LJGI|TC79489 similar to UniRef100_Q5DVT9 Cluster: Plasma mem...   176   1e-43
gnl|LJGI|TC71830 homologue to UniRef100_Q2HV44 Cluster: Major in...   174   6e-43
gnl|LJGI|TC72638 homologue to UniRef100_O65357 Cluster: Aquapori...   153   2e-36
gnl|LJGI|TC65853 homologue to UniRef100_Q9ATM4 Cluster: Aquapori...   115   5e-25
gnl|LJGI|TC78096 homologue to UniRef100_Q8W1A8 Cluster: Aquapori...   113   2e-24
gnl|LJGI|BW598844 homologue to UniRef100_O65357 Cluster: Aquapor...   105   4e-22
gnl|LJGI|BI420390 homologue to UniRef100_Q5U7L0 Cluster: Plasma ...    94   2e-18
gnl|LJGI|AV415328 homologue to UniRef100_Q946J9 Cluster: Aquapor...    64   2e-09
gnl|LJGI|DN652353 UniRef100_A3F571 Cluster: Aquaporin; n=1; Cucu...    60   2e-08

>gnl|LJGI|TC67926 homologue to UniRef100_Q06Z30 Cluster: Aquaporin 1; n=1; Gossypium
            hirsutum|Rep: Aquaporin 1 - Gossypium hirsutum (Upland
            cotton) (Gossypium mexicanum), partial (98%)
          Length = 1615

 Score = 1695 bits (855), Expect = 0.0
 Identities = 855/855 (100%)
 Strand = Plus / Plus

                                                                        
Query: 1    atggcttctgaagatgtgaaagttggagcaaacaaattctcagagaggcatgcattgggc 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 149  atggcttctgaagatgtgaaagttggagcaaacaaattctcagagaggcatgcattgggc 208

                                                                        
Query: 61   acagaagctcagggtgacaaggactacaaggagccacctccagcacccttgtttgagcca 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 209  acagaagctcagggtgacaaggactacaaggagccacctccagcacccttgtttgagcca 268

                                                                        
Query: 121  ggggagctgaagtcatggtcattttacagagctggaattgctgagtttgtagccaccttc 180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 269  ggggagctgaagtcatggtcattttacagagctggaattgctgagtttgtagccaccttc 328

                                                                        
Query: 181  ttgttcctctacatcactgtcttaactgtcatgggtgtcaataggtcacccaacaagtgt 240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 329  ttgttcctctacatcactgtcttaactgtcatgggtgtcaataggtcacccaacaagtgt 388

                                                                        
Query: 241  tcctctgttggcatccaaggtattgcttgggcttttggtggcatgatctttgcccttgtc 300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 389  tcctctgttggcatccaaggtattgcttgggcttttggtggcatgatctttgcccttgtc 448

                                                                        
Query: 301  tactgcacagctggaatatcaggtgggcacattaatccggctgtgacgttcggtctgttt 360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 449  tactgcacagctggaatatcaggtgggcacattaatccggctgtgacgttcggtctgttt 508

                                                                        
Query: 361  ttggcgaggaagctgtcgctcacccgagcgctgttctacattgtgatgcagtgccttgga 420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 509  ttggcgaggaagctgtcgctcacccgagcgctgttctacattgtgatgcagtgccttgga 568

                                                                        
Query: 421  gctatctgcggtgctggtgtggtgaagggttttgagggcaatgctcgctttgagatgttc 480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 569  gctatctgcggtgctggtgtggtgaagggttttgagggcaatgctcgctttgagatgttc 628

                                                                        
Query: 481  aaaggtggagcaaatgttgtgaatcctggatataccaagggtgatggccttggagctgag 540
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 629  aaaggtggagcaaatgttgtgaatcctggatataccaagggtgatggccttggagctgag 688

                                                                        
Query: 541  attgtcggtacctttgttcttgtctacactgtcttctctgccactgatgccaagagaaat 600
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 689  attgtcggtacctttgttcttgtctacactgtcttctctgccactgatgccaagagaaat 748

                                                                        
Query: 601  gccagagactctcatgttccgcttttggccccccttcccattggatttgctgtgttcttg 660
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 749  gccagagactctcatgttccgcttttggccccccttcccattggatttgctgtgttcttg 808

                                                                        
Query: 661  gtccacttggctaccattcccatcacaggaactggcattaacccagctaggagtcttggt 720
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 809  gtccacttggctaccattcccatcacaggaactggcattaacccagctaggagtcttggt 868

                                                                        
Query: 721  gctgccattatatacaacagagaccatgcttgggatgaccattggattttctgggttgga 780
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 869  gctgccattatatacaacagagaccatgcttgggatgaccattggattttctgggttgga 928

                                                                        
Query: 781  cctttcattggagctgctcttgctgctgtgtatcaccagatagtaatccgagcaattcct 840
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 929  cctttcattggagctgctcttgctgctgtgtatcaccagatagtaatccgagcaattcct 988

                           
Query: 841  ttcaagacaaggggt 855
            |||||||||||||||
Sbjct: 989  ttcaagacaaggggt 1003


>gnl|LJGI|TC80996 similar to UniRef100_Q06Z30 Cluster: Aquaporin 1; n=1; Gossypium
           hirsutum|Rep: Aquaporin 1 - Gossypium hirsutum (Upland
           cotton) (Gossypium mexicanum), complete
          Length = 1192

 Score = 1001 bits (505), Expect = 0.0
 Identities = 762/847 (89%), Gaps = 3/847 (0%)
 Strand = Plus / Plus

                                                                       
Query: 10  gaagatgtgaaagttggagcaaacaaattctcagagaggcatgcattgggcacagaagct 69
           |||||||| || ||||||||||||||||||||||| || ||  |||| || |||| ||| 
Sbjct: 76  gaagatgttaaggttggagcaaacaaattctcagaaagacaaccattagggacagcagca 135

                                                                       
Query: 70  cagggtgacaa---ggactacaaggagccacctccagcacccttgtttgagccaggggag 126
           ||| |||||||   ||| |||||||||||||| ||||| || || |||||||||||||||
Sbjct: 136 cagagtgacaacaaggattacaaggagccacccccagctccattttttgagccaggggag 195

                                                                       
Query: 127 ctgaagtcatggtcattttacagagctggaattgctgagtttgtagccaccttcttgttc 186
           || ||||||||||| |||||||||||||| |||||||||||  |||||||||||||||||
Sbjct: 196 ctcaagtcatggtctttttacagagctggcattgctgagttcatagccaccttcttgttc 255

                                                                       
Query: 187 ctctacatcactgtcttaactgtcatgggtgtcaataggtcacccaacaagtgttcctct 246
           |||||||| ||  |||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 256 ctctacattaccatcttaactgtcatgggtgtcaacaggtcacccaacaagtgttcctct 315

                                                                       
Query: 247 gttggcatccaaggtattgcttgggcttttggtggcatgatctttgcccttgtctactgc 306
           |||||||| || || ||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 316 gttggcattcagggcattgcttggtcttttggtggcatgatctttgcccttgtctactgc 375

                                                                       
Query: 307 acagctggaatatcaggtgggcacattaatccggctgtgacgttcggtctgtttttggcg 366
           || |||||||| |||||||| ||||| || || |||||||| || ||||| ||| |||| 
Sbjct: 376 actgctggaatttcaggtggacacataaacccagctgtgacctttggtctctttctggct 435

                                                                       
Query: 367 aggaagctgtcgctcacccgagcgctgttctacattgtgatgcagtgccttggagctatc 426
           |||||||| || |||||  |||| |||||||||||||||||||| |||||||||||||||
Sbjct: 436 aggaagctctccctcacaagagcactgttctacattgtgatgcaatgccttggagctatc 495

                                                                       
Query: 427 tgcggtgctggtgtggtgaagggttttgagggcaatgctcgctttgagatgttcaaaggt 486
           || |||||||||||||||||||| |||||||| |||||| | | |||| |||||||||||
Sbjct: 496 tgtggtgctggtgtggtgaaggggtttgagggtaatgctaggtatgagttgttcaaaggt 555

                                                                       
Query: 487 ggagcaaatgttgtgaatcctggatataccaagggtgatggccttggagctgagattgtc 546
           ||||| ||| ||||||||||||||||||||||||||||||| ||||||||||||||||| 
Sbjct: 556 ggagctaattttgtgaatcctggatataccaagggtgatggacttggagctgagattgtt 615

                                                                       
Query: 547 ggtacctttgttcttgtctacactgtcttctctgccactgatgccaagagaaatgccaga 606
           || |||||||||||||||||||| || |||||||||||||||||||||||||| || |||
Sbjct: 616 ggcacctttgttcttgtctacaccgttttctctgccactgatgccaagagaaacgctaga 675

                                                                       
Query: 607 gactctcatgttccgcttttggccccccttcccattggatttgctgtgttcttggtccac 666
           ||||||||||||||  ||||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 676 gactctcatgttcctattttggctccccttcccattgggtttgctgtgttcttggtccac 735

                                                                       
Query: 667 ttggctaccattcccatcacaggaactggcattaacccagctaggagtcttggtgctgcc 726
           ||||| ||||||||||||||||||||||| ||||||||||||||||||||||| ||||| 
Sbjct: 736 ttggccaccattcccatcacaggaactggaattaacccagctaggagtcttggagctgct 795

                                                                       
Query: 727 attatatacaacagagaccatgcttgggatgaccattggattttctgggttggacctttc 786
            | || | |||||| |||   || ||||||| ||||||||||||||||||||||||||||
Sbjct: 796 ttaatcttcaacagggacttggcatgggatggccattggattttctgggttggacctttc 855

                                                                       
Query: 787 attggagctgctcttgctgctgtgtatcaccagatagtaatccgagcaattcctttcaag 846
           ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 856 attggagctgcccttgctgctgtgtatcaccagatagtaatccgagccattcctttcaag 915

                  
Query: 847 acaaggg 853
           |||||||
Sbjct: 916 acaaggg 922


>gnl|LJGI|TC80088 homologue to UniRef100_Q946J9 Cluster: Aquaporin protein PIP1;1;
           n=1; Medicago truncatula|Rep: Aquaporin protein PIP1;1 -
           Medicago truncatula (Barrel medic), complete
          Length = 1362

 Score =  220 bits (111), Expect = 1e-56
 Identities = 252/299 (84%)
 Strand = Plus / Plus

                                                                       
Query: 505 cctggatataccaagggtgatggccttggagctgagattgtcggtacctttgttcttgtc 564
           ||||| || |||||||||||||| || || ||||||||||| || |||||||||||||| 
Sbjct: 634 cctggttacaccaagggtgatggtctcggtgctgagattgttggcacctttgttcttgtt 693

                                                                       
Query: 565 tacactgtcttctctgccactgatgccaagagaaatgccagagactctcatgttccgctt 624
           ||||| |||||||| ||||| ||||| ||| | |  |||||||||||||| || ||  ||
Sbjct: 694 tacaccgtcttctccgccaccgatgctaagcgtagcgccagagactctcacgtccccatt 753

                                                                       
Query: 625 ttggccccccttcccattggatttgctgtgttcttggtccacttggctaccattcccatc 684
           ||||| || || || ||||| || |||||||||||||| || ||||||||||| ||||| 
Sbjct: 754 ttggcacctctgcctattgggttcgctgtgttcttggtgcatttggctaccatccccatt 813

                                                                       
Query: 685 acaggaactggcattaacccagctaggagtcttggtgctgccattatatacaacagagac 744
           ||||||||||| || ||||| ||||||||||| |||||||||||||| | |||||  |||
Sbjct: 814 acaggaactggtatcaaccctgctaggagtctcggtgctgccattatcttcaacaaggac 873

                                                                      
Query: 745 catgcttgggatgaccattggattttctgggttggacctttcattggagctgctcttgc 803
           | ||  |||||||| || ||||| |||||||| ||||| ||||| ||||||||||||||
Sbjct: 874 cgtggctgggatgatcactggatcttctgggtgggaccattcatcggagctgctcttgc 932



 Score =  145 bits (73), Expect = 5e-34
 Identities = 304/381 (79%)
 Strand = Plus / Plus

                                                                       
Query: 78  caaggactacaaggagccacctccagcacccttgtttgagccaggggagctgaagtcatg 137
           |||||||||| |||||||||| || || ||  ||||||||||   |||||| |  |||||
Sbjct: 207 caaggactaccaggagccaccacctgcgccgctgtttgagccgtcggagctcacctcatg 266

                                                                       
Query: 138 gtcattttacagagctggaattgctgagtttgtagccaccttcttgttcctctacatcac 197
           ||| || |||||||| || ||||| |||||||| ||||||||  ||||||||||||||||
Sbjct: 267 gtccttctacagagccggtattgccgagtttgttgccacctttctgttcctctacatcac 326

                                                                       
Query: 198 tgtcttaactgtcatgggtgtcaataggtcacccaacaagtgttcctctgttggcatcca 257
            ||||| || |||||||||||||   |  |    | ||||||     ||||||| || ||
Sbjct: 327 cgtcttgaccgtcatgggtgtcagcggtgccgatagcaagtgcaaaactgttggtattca 386

                                                                       
Query: 258 aggtattgcttgggcttttggtggcatgatctttgcccttgtctactgcacagctggaat 317
           ||| |||||||||||||| |||||||||||||| || || || |||||||| || |||||
Sbjct: 387 agggattgcttgggctttcggtggcatgatcttcgctctcgtttactgcaccgccggaat 446

                                                                       
Query: 318 atcaggtgggcacattaatccggctgtgacgttcggtctgtttttggcgaggaagctgtc 377
            ||||| || ||||| || ||||||||||| || || |||||||||||||||||| ||||
Sbjct: 447 ctcaggaggtcacataaacccggctgtgacttttgggctgtttttggcgaggaagttgtc 506

                                                                       
Query: 378 gctcacccgagcgctgttctacattgtgatgcagtgccttggagctatctgcggtgctgg 437
             | ||  | ||  | |||||||| |||||||||||||| || |||||    || || ||
Sbjct: 507 cttgacaagggctattttctacatcgtgatgcagtgcctgggtgctattgttggcgccgg 566

                                
Query: 438 tgtggtgaagggttttgaggg 458
            |||||||| |||||||||||
Sbjct: 567 cgtggtgaaaggttttgaggg 587


>gnl|LJGI|TC74931 homologue to UniRef100_A0T2N6 Cluster: PIP1 protein; n=1; Gossypium
           hirsutum|Rep: PIP1 protein - Gossypium hirsutum (Upland
           cotton) (Gossypium mexicanum), partial (38%)
          Length = 805

 Score =  200 bits (101), Expect = 1e-50
 Identities = 227/269 (84%)
 Strand = Plus / Plus

                                                                       
Query: 535 gctgagattgtcggtacctttgttcttgtctacactgtcttctctgccactgatgccaag 594
           ||||||||||| || |||||||||||||| ||||| |||||||| ||||| ||||| |||
Sbjct: 10  gctgagattgttggcacctttgttcttgtttacaccgtcttctccgccaccgatgctaag 69

                                                                       
Query: 595 agaaatgccagagactctcatgttccgcttttggccccccttcccattggatttgctgtg 654
            | |  |||||||||||||| || ||  ||||||| || || || ||||| || ||||||
Sbjct: 70  cgtagcgccagagactctcacgtccccattttggcacctctgcctattgggttcgctgtg 129

                                                                       
Query: 655 ttcttggtccacttggctaccattcccatcacaggaactggcattaacccagctaggagt 714
           |||||||| || ||||||||||| ||||| ||||||||||| || ||||| |||||||||
Sbjct: 130 ttcttggtgcatttggctaccatccccattacaggaactggtatcaaccctgctaggagt 189

                                                                       
Query: 715 cttggtgctgccattatatacaacagagaccatgcttgggatgaccattggattttctgg 774
           || |||||||||||||| | |||||  |||| ||  |||||||| || ||||| ||||||
Sbjct: 190 ctcggtgctgccattatcttcaacaaggaccgtggctgggatgatcactggatcttctgg 249

                                        
Query: 775 gttggacctttcattggagctgctcttgc 803
           || ||||| ||||| ||||||||||||||
Sbjct: 250 gtgggaccattcatcggagctgctcttgc 278


>gnl|LJGI|TC71350 similar to UniRef100_A3F570 Cluster: Aquaporin; n=1; Cucumis
           sativus|Rep: Aquaporin - Cucumis sativus (Cucumber),
           partial (97%)
          Length = 1168

 Score =  196 bits (99), Expect = 2e-49
 Identities = 270/327 (82%)
 Strand = Plus / Plus

                                                                       
Query: 520 ggtgatggccttggagctgagattgtcggtacctttgttcttgtctacactgtcttctct 579
           ||||||||||||||||| |||||||| || || ||||| ||||| |||||||| ||||||
Sbjct: 611 ggtgatggccttggagcagagattgttggcacatttgtgcttgtttacactgtgttctct 670

                                                                       
Query: 580 gccactgatgccaagagaaatgccagagactctcatgttccgcttttggccccccttccc 639
           || |||||||||||| |||| ||  ||||||| ||  ||||  ||||||| || || |||
Sbjct: 671 gctactgatgccaagcgaaacgcacgagactcgcacattcctattttggcaccactaccc 730

                                                                       
Query: 640 attggatttgctgtgttcttggtccacttggctaccattcccatcacaggaactggcatt 699
           ||||| |||||||||||  |||| || |||||||| ||||||||||| |||||||| || 
Sbjct: 731 attggttttgctgtgtttctggtgcatttggctacaattcccatcactggaactggtatc 790

                                                                       
Query: 700 aacccagctaggagtcttggtgctgccattatatacaacagagaccatgcttgggatgac 759
           ||||| || || ||||| ||||| ||| |||| | |||||  ||||| || |||||||||
Sbjct: 791 aaccctgccagaagtctaggtgcagcccttattttcaacaaggaccaagcgtgggatgac 850

                                                                       
Query: 760 cattggattttctgggttggacctttcattggagctgctcttgctgctgtgtatcaccag 819
           |||||||| || ||||| || || |||||||| || || ||||| ||| ||||||| |||
Sbjct: 851 cattggatattttgggtagggccattcattggggcagcacttgcagctctgtatcatcag 910

                                      
Query: 820 atagtaatccgagcaattcctttcaag 846
           ||||| ||| | || ||||| ||||||
Sbjct: 911 atagtgatcagggccattcccttcaag 937



 Score = 95.6 bits (48), Expect = 4e-19
 Identities = 225/284 (79%)
 Strand = Plus / Plus

                                                                       
Query: 82  gactacaaggagccacctccagcacccttgtttgagccaggggagctgaagtcatggtca 141
           |||||||| ||||| ||  ||||||| || || ||||| || ||||||   |||||||| 
Sbjct: 176 gactacaaagagcctccctcagcacctttcttcgagcccggcgagctgtcatcatggtcc 235

                                                                       
Query: 142 ttttacagagctggaattgctgagtttgtagccaccttcttgttcctctacatcactgtc 201
           || |||||||| || || || ||||| || ||||| |||||||| || |||||||| || 
Sbjct: 236 ttctacagagccggcatagcagagttcgtcgccacgttcttgtttctttacatcaccgtg 295

                                                                       
Query: 202 ttaactgtcatgggtgtcaataggtcacccaacaagtgttcctctgttggcatccaaggt 261
           |||||||| ||||||||   ||  ||    | |||||||||| |||||||  ||||||| 
Sbjct: 296 ttaactgtgatgggtgtggctaaatccaagagcaagtgttccactgttggtgtccaaggc 355

                                                                       
Query: 262 attgcttgggcttttggtggcatgatctttgcccttgtctactgcacagctggaatatca 321
           || |||||| | |||||||| ||||||||||| |||||||| ||||| ||||| || |||
Sbjct: 356 atagcttggtcatttggtggaatgatctttgctcttgtctattgcactgctggcatctca 415

                                                       
Query: 322 ggtgggcacattaatccggctgtgacgttcggtctgtttttggc 365
           || || ||||| || || || ||||| || || ||||| |||||
Sbjct: 416 gggggtcacataaacccagcagtgacatttgggctgttcttggc 459


>gnl|LJGI|NP459447 GB|AF145708.1|AAD35016.1 plasma membrane intrinsic protein homolog
           [Lotus japonicus]
          Length = 578

 Score =  194 bits (98), Expect = 6e-49
 Identities = 251/302 (83%)
 Strand = Plus / Plus

                                                                       
Query: 148 agagctggaattgctgagtttgtagccaccttcttgttcctctacatcactgtcttaact 207
           |||||||| |||||||||||| |||| || || |||||||| ||||||||||| || |||
Sbjct: 64  agagctgggattgctgagtttatagctacgtttttgttcctgtacatcactgttttgact 123

                                                                       
Query: 208 gtcatgggtgtcaataggtcacccaacaagtgttcctctgttggcatccaaggtattgct 267
           || |||||||| || |||||||| |||| |||| | || || || ||||||||||| |||
Sbjct: 124 gttatgggtgtgaagaggtcaccgaacatgtgtgcttccgtcggaatccaaggtatcgct 183

                                                                       
Query: 268 tgggcttttggtggcatgatctttgcccttgtctactgcacagctggaatatcaggtggg 327
           |||||||| ||||| |||||||| || || ||||||||||| ||||| || || ||||| 
Sbjct: 184 tgggctttcggtggtatgatcttcgctctcgtctactgcaccgctggtatctccggtgga 243

                                                                       
Query: 328 cacattaatccggctgtgacgttcggtctgtttttggcgaggaagctgtcgctcacccga 387
           ||||| || || || || ||||||||| | || || || |||||||| |||||||| |||
Sbjct: 244 cacatcaacccagcggttacgttcggtttattcttagctaggaagctttcgctcacacga 303

                                                                       
Query: 388 gcgctgttctacattgtgatgcagtgccttggagctatctgcggtgctggtgtggtgaag 447
           ||  ||| |||||| |||||||||||| | ||||||||||| || || |||||||| |||
Sbjct: 304 gctgtgtactacatagtgatgcagtgcttaggagctatctgtggagcgggtgtggtcaag 363

             
Query: 448 gg 449
           ||
Sbjct: 364 gg 365



 Score =  107 bits (54), Expect = 1e-22
 Identities = 114/134 (85%)
 Strand = Plus / Plus

                                                                       
Query: 529 cttggagctgagattgtcggtacctttgttcttgtctacactgtcttctctgccactgat 588
           ||||||||||||||| | || |||||||| ||||| ||||| ||||||||||||||||||
Sbjct: 442 cttggagctgagattattggaacctttgtccttgtttacaccgtcttctctgccactgat 501

                                                                       
Query: 589 gccaagagaaatgccagagactctcatgttccgcttttggccccccttcccattggattt 648
           ||||||||||| ||  | ||||||||||||||  || | || || || || || ||||| 
Sbjct: 502 gccaagagaaacgctcgtgactctcatgttcctattctagcaccgctccctatcggattc 561

                         
Query: 649 gctgtgttcttggt 662
           ||||||||||||||
Sbjct: 562 gctgtgttcttggt 575


>gnl|LJGI|TC67210 homologue to UniRef100_O22339 Cluster: Aquaporin-like transmembrane
           channel protein; n=1; Medicago sativa|Rep:
           Aquaporin-like transmembrane channel protein - Medicago
           sativa (Alfalfa), complete
          Length = 1162

 Score =  180 bits (91), Expect = 9e-45
 Identities = 247/299 (82%)
 Strand = Plus / Plus

                                                                       
Query: 505 cctggatataccaagggtgatggccttggagctgagattgtcggtacctttgttcttgtc 564
           ||||| || ||||| ||||| ||||| || ||||||||||| || ||||| |||||||||
Sbjct: 577 cctggctacaccaaaggtgacggcctcggtgctgagattgttggcaccttcgttcttgtc 636

                                                                       
Query: 565 tacactgtcttctctgccactgatgccaagagaaatgccagagactctcatgttccgctt 624
           ||||| |||||||| ||||| ||||||||| |    |||||||||||||| |||||  ||
Sbjct: 637 tacaccgtcttctcagccacggatgccaagcgttccgccagagactctcacgttccaatt 696

                                                                       
Query: 625 ttggccccccttcccattggatttgctgtgttcttggtccacttggctaccattcccatc 684
           ||||| ||  | || ||||| || || ||||||||||| |||||||| ||||| || |||
Sbjct: 697 ttggcaccattgccaattgggttcgcggtgttcttggtacacttggcaaccatcccaatc 756

                                                                       
Query: 685 acaggaactggcattaacccagctaggagtcttggtgctgccattatatacaacagagac 744
           || ||||| || || ||||| ||| ||||||| || ||| ||||  | |  |||| ||||
Sbjct: 757 accggaaccggtatcaaccctgctcggagtctcggcgcttccatagtctttaacaaagac 816

                                                                      
Query: 745 catgcttgggatgaccattggattttctgggttggacctttcattggagctgctcttgc 803
           | ||  ||||||||||| |||||||||||||||||||||||||||||||| ||||||||
Sbjct: 817 cttggctgggatgaccactggattttctgggttggacctttcattggagcagctcttgc 875



 Score =  123 bits (62), Expect = 2e-27
 Identities = 176/214 (82%)
 Strand = Plus / Plus

                                                                       
Query: 245 ctgttggcatccaaggtattgcttgggcttttggtggcatgatctttgcccttgtctact 304
           ||||||| || ||||| ||||||||||||||||||||||||||||| || || || ||||
Sbjct: 316 ctgttgggattcaaggaattgcttgggcttttggtggcatgatcttcgcactcgtttact 375

                                                                       
Query: 305 gcacagctggaatatcaggtgggcacattaatccggctgtgacgttcggtctgtttttgg 364
           |||| |||||||| || || || ||||| || || || ||||| || |||||||| ||||
Sbjct: 376 gcactgctggaatctctgggggtcacataaacccagcggtgacatttggtctgttcttgg 435

                                                                       
Query: 365 cgaggaagctgtcgctcacccgagcgctgttctacattgtgatgcagtgccttggagcta 424
           | |||||  ||||  | ||  | ||| |||||||||| |||||||||   || || ||||
Sbjct: 436 caaggaaattgtcattgacaagggcggtgttctacatggtgatgcaggtgctaggtgcta 495

                                             
Query: 425 tctgcggtgctggtgtggtgaagggttttgaggg 458
           | ||||| |||||||||||||||||||| |||||
Sbjct: 496 tatgcggcgctggtgtggtgaagggtttcgaggg 529


>gnl|LJGI|TC79489 similar to UniRef100_Q5DVT9 Cluster: Plasma membrane intrinsic
           protein 2;1; n=1; Mimosa pudica|Rep: Plasma membrane
           intrinsic protein 2;1 - Mimosa pudica (Sensitive plant),
           partial (95%)
          Length = 1169

 Score =  176 bits (89), Expect = 1e-43
 Identities = 218/261 (83%)
 Strand = Plus / Plus

                                                                       
Query: 535 gctgagattgtcggtacctttgttcttgtctacactgtcttctctgccactgatgccaag 594
           ||||||||| | || ||||| ||||||||||||||||| ||||||||||||||| | |||
Sbjct: 558 gctgagattattggcaccttcgttcttgtctacactgttttctctgccactgatcctaag 617

                                                                       
Query: 595 agaaatgccagagactctcatgttccgcttttggccccccttcccattggatttgctgtg 654
           ||||| || || || || ||||||||  ||||||| || ||||| |||||||||||||||
Sbjct: 618 agaaacgctagggattcccatgttcctgttttggctccacttcctattggatttgctgtg 677

                                                                       
Query: 655 ttcttggtccacttggctaccattcccatcacaggaactggcattaacccagctaggagt 714
           ||| |||| ||||||||||| || ||  | || || ||||| ||||||||||| ||||||
Sbjct: 678 ttcatggttcacttggctacaatccctgttactggtactggaattaacccagcaaggagt 737

                                                                       
Query: 715 cttggtgctgccattatatacaacagagaccatgcttgggatgaccattggattttctgg 774
            |||| |||||  | || ||||||  |||| |    ||||||||||||||||||||||||
Sbjct: 738 tttggagctgctgtcatctacaacgaagacaaaatctgggatgaccattggattttctgg 797

                                
Query: 775 gttggacctttcattggagct 795
           |||||||| || |||||||||
Sbjct: 798 gttggaccatttattggagct 818



 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 259 ggtattgcttgggcttttggtggcatgatctttgcccttgtctactgcac 308
           |||||||||||||| |||||||||||||||||   |||||| ||||||||
Sbjct: 286 ggtattgcttgggcctttggtggcatgatcttcatccttgtttactgcac 335


>gnl|LJGI|TC71830 homologue to UniRef100_Q2HV44 Cluster: Major intrinsic protein;
           n=1; Medicago truncatula|Rep: Major intrinsic protein -
           Medicago truncatula (Barrel medic), partial (97%)
          Length = 1178

 Score =  174 bits (88), Expect = 6e-43
 Identities = 226/272 (83%)
 Strand = Plus / Plus

                                                                       
Query: 535 gctgagattgtcggtacctttgttcttgtctacactgtcttctctgccactgatgccaag 594
           ||||||||| |||| |||||||| ||||||||||| |||||||| ||||| ||| |||||
Sbjct: 585 gctgagattatcggcacctttgtccttgtctacaccgtcttctccgccaccgatcccaag 644

                                                                       
Query: 595 agaaatgccagagactctcatgttccgcttttggccccccttcccattggatttgctgtg 654
           ||||| |||||||| || ||||||||  ||||||| || ||||| ||||| ||||| |||
Sbjct: 645 agaaacgccagagattcccatgttcctgttttggcacctcttccaattgggtttgcagtg 704

                                                                       
Query: 655 ttcttggtccacttggctaccattcccatcacaggaactggcattaacccagctaggagt 714
           ||| |||| |||||||| ||||| |||||||| ||||| || || ||||| ||||| || 
Sbjct: 705 ttcatggttcacttggccaccatccccatcactggaaccggaatcaaccctgctagaagc 764

                                                                       
Query: 715 cttggtgctgccattatatacaacagagaccatgcttgggatgaccattggattttctgg 774
            | || |||||  | ||||||||||  ||  | || ||||||||||| ||||| ||||||
Sbjct: 765 ttcggagctgctgtcatatacaacaacgagaaggcatgggatgaccagtggatcttctgg 824

                                           
Query: 775 gttggacctttcattggagctgctcttgctgc 806
           || |||||||||||||| ||| || |||||||
Sbjct: 825 gtgggacctttcattggtgctactattgctgc 856



 Score = 52.0 bits (26), Expect = 6e-06
 Identities = 101/126 (80%)
 Strand = Plus / Plus

                                                                       
Query: 247 gttggcatccaaggtattgcttgggcttttggtggcatgatctttgcccttgtctactgc 306
           ||||||||||  || || |||||||| || || |||||||| ||   ||| || ||||||
Sbjct: 300 gttggcatcctcggcatcgcttgggccttcggcggcatgattttcatcctcgtttactgc 359

                                                                       
Query: 307 acagctggaatatcaggtgggcacattaatccggctgtgacgttcggtctgtttttggcg 366
           || || || || ||||| || ||||| || ||||| |||||||||||| ||||  |||||
Sbjct: 360 accgccggcatctcagggggtcacataaacccggcggtgacgttcggtttgttcctggcg 419

                 
Query: 367 aggaag 372
           ||||||
Sbjct: 420 aggaag 425


>gnl|LJGI|TC72638 homologue to UniRef100_O65357 Cluster: Aquaporin 2; n=1; Samanea
           saman|Rep: Aquaporin 2 - Samanea saman (Rain tree),
           complete
          Length = 1276

 Score =  153 bits (77), Expect = 2e-36
 Identities = 203/245 (82%)
 Strand = Plus / Plus

                                                                       
Query: 547 ggtacctttgttcttgtctacactgtcttctctgccactgatgccaagagaaatgccaga 606
           |||||||||||| | || ||||| || |||||||| |||||| |||| |||| |||||||
Sbjct: 632 ggtacctttgttttggtatacacagtgttctctgctactgatcccaaaagaagtgccaga 691

                                                                       
Query: 607 gactctcatgttccgcttttggccccccttcccattggatttgctgtgttcttggtccac 666
           || || ||||| ||| ||||||| || |||||||||||||||||||||||| |||| |||
Sbjct: 692 gattcccatgtgccggttttggctccacttcccattggatttgctgtgttcatggttcac 751

                                                                       
Query: 667 ttggctaccattcccatcacaggaactggcattaacccagctaggagtcttggtgctgcc 726
           ||||| ||||| ||  |||| || |||||||||||||| ||||||||| |||| ||||| 
Sbjct: 752 ttggccaccatcccagtcactggtactggcattaaccctgctaggagttttggagctgct 811

                                                                       
Query: 727 attatatacaacagagaccatgcttgggatgaccattggattttctgggttggacctttc 786
            |||| | ||||  |    |  | ||||||||||||||||| |||||||| ||||| |||
Sbjct: 812 gttatcttcaaccaatctaaaccctgggatgaccattggatcttctgggtaggaccattc 871

                
Query: 787 attgg 791
           |||||
Sbjct: 872 attgg 876



 Score = 79.8 bits (40), Expect = 3e-14
 Identities = 100/120 (83%)
 Strand = Plus / Plus

                                                                       
Query: 246 tgttggcatccaaggtattgcttgggcttttggtggcatgatctttgcccttgtctactg 305
           ||||||||| |  |||||||||||||| |||||||||||||||||   |||||| |||||
Sbjct: 334 tgttggcattcttggtattgcttgggcctttggtggcatgatcttcatccttgtttactg 393

                                                                       
Query: 306 cacagctggaatatcaggtgggcacattaatccggctgtgacgttcggtctgtttttggc 365
           ||| ||||| || ||||| || |||||||| || || ||||| || || ||||| |||||
Sbjct: 394 caccgctgggatctcagggggtcacattaacccagcagtgacatttgggctgttcttggc 453


>gnl|LJGI|TC65853 homologue to UniRef100_Q9ATM4 Cluster: Aquaporin PIP2-7; n=1; Zea
           mays|Rep: Aquaporin PIP2-7 - Zea mays (Maize), complete
          Length = 1346

 Score =  115 bits (58), Expect = 5e-25
 Identities = 142/170 (83%)
 Strand = Plus / Plus

                                                                       
Query: 550 acctttgttcttgtctacactgtcttctctgccactgatgccaagagaaatgccagagac 609
           ||||||||||||||||||||||| |||||||| |||||| | ||||| || || || || 
Sbjct: 706 acctttgttcttgtctacactgttttctctgctactgatcctaagaggaacgctagggat 765

                                                                       
Query: 610 tctcatgttccgcttttggccccccttcccattggatttgctgtgttcttggtccacttg 669
           || ||||||||  |  |||| || ||||| |||||||||||||||||| |||| ||||||
Sbjct: 766 tcccatgttcctgtactggcaccacttccaattggatttgctgtgttcatggttcacttg 825

                                                             
Query: 670 gctaccattcccatcacaggaactggcattaacccagctaggagtcttgg 719
           ||||| || ||  | || || ||||||||||||||||| |||||| ||||
Sbjct: 826 gctacaatccctgttactggcactggcattaacccagcaaggagttttgg 875



 Score = 73.8 bits (37), Expect = 2e-12
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                       
Query: 259 ggtattgcttgggcttttggtggcatgatctttgcccttgtctactgcacagctggaata 318
           ||||| |||||||| ||||||||||||||||| | |||||| |||||||| || || || 
Sbjct: 418 ggtatagcttgggcctttggtggcatgatcttcgtccttgtttactgcaccgccggtatc 477

                                        
Query: 319 tcaggtgggcacattaatccggctgtgac 347
           ||||| ||||| ||||| || ||||||||
Sbjct: 478 tcaggagggcatattaaccctgctgtgac 506


>gnl|LJGI|TC78096 homologue to UniRef100_Q8W1A8 Cluster: Aquaporin-like protein; n=1;
           Petunia x hybrida|Rep: Aquaporin-like protein - Petunia
           hybrida (Petunia), partial (30%)
          Length = 800

 Score =  113 bits (57), Expect = 2e-24
 Identities = 144/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 623 ttttggccccccttcccattggatttgctgtgttcttggtccacttggctaccattccca 682
           ||||||| || ||||| |||||||||||||||||| |||| ||||||||||| || ||  
Sbjct: 6   ttttggctccacttcctattggatttgctgtgttcatggttcacttggctacaatccctg 65

                                                                       
Query: 683 tcacaggaactggcattaacccagctaggagtcttggtgctgccattatatacaacagag 742
           | || || ||||| ||||||||||| |||||| |||| |||||  | || ||||||  ||
Sbjct: 66  ttactggtactggaattaacccagcaaggagttttggagctgctgtcatctacaacgaag 125

                                                                
Query: 743 accatgcttgggatgaccattggattttctgggttggacctttcattggagct 795
           || |    |||||||||||||||||||||||||||||||| || |||||||||
Sbjct: 126 acaaaatctgggatgaccattggattttctgggttggaccatttattggagct 178


>gnl|LJGI|BW598844 homologue to UniRef100_O65357 Cluster: Aquaporin 2; n=1; Samanea
           saman|Rep: Aquaporin 2 - Samanea saman (Rain tree),
           partial (31%)
          Length = 479

 Score =  105 bits (53), Expect = 4e-22
 Identities = 140/169 (82%)
 Strand = Plus / Plus

                                                                       
Query: 623 ttttggccccccttcccattggatttgctgtgttcttggtccacttggctaccattccca 682
           ||||||| || |||||||||||||||||||||||| |||| |||||||| ||||| ||  
Sbjct: 80  ttttggctccacttcccattggatttgctgtgttcatggttcacttggccaccatcccag 139

                                                                       
Query: 683 tcacaggaactggcattaacccagctaggagtcttggtgctgccattatatacaacagag 742
           |||| || |||||||||||||| ||||||||| |||| |||||  |||| | ||||  | 
Sbjct: 140 tcactggtactggcattaaccctgctaggagttttggagctgctgttatcttcaaccaat 199

                                                            
Query: 743 accatgcttgggatgaccattggattttctgggttggacctttcattgg 791
              |  | ||||||||||||||||| |||||||| ||||| ||||||||
Sbjct: 200 ctaagccctgggatgaccattggatcttctgggtaggaccattcattgg 248


>gnl|LJGI|BI420390 homologue to UniRef100_Q5U7L0 Cluster: Plasma membrane intrinsic
           protein; n=1; Glycyrrhiza uralensis|Rep: Plasma membrane
           intrinsic protein - Glycyrrhiza uralensis, partial (51%)
          Length = 493

 Score = 93.7 bits (47), Expect = 2e-18
 Identities = 107/127 (84%)
 Strand = Plus / Plus

                                                                       
Query: 245 ctgttggcatccaaggtattgcttgggcttttggtggcatgatctttgcccttgtctact 304
           ||||||| || ||||| ||||||||||||||||||||||||||||| || || || ||||
Sbjct: 299 ctgttgggattcaaggaattgcttgggcttttggtggcatgatcttcgcactcgtttact 358

                                                                       
Query: 305 gcacagctggaatatcaggtgggcacattaatccggctgtgacgttcggtctgtttttgg 364
           |||| |||||||| || || || ||||| || || || ||||| || |||||||| ||||
Sbjct: 359 gcactgctggaatctctgggggtcacataaacccagcggtgacatttggtctgttcttgg 418

                  
Query: 365 cgaggaa 371
           | |||||
Sbjct: 419 caaggaa 425


>gnl|LJGI|AV415328 homologue to UniRef100_Q946J9 Cluster: Aquaporin protein PIP1;1;
           n=1; Medicago truncatula|Rep: Aquaporin protein PIP1;1 -
           Medicago truncatula (Barrel medic), partial (27%)
          Length = 264

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 165 gtttgtagccaccttcttgttcctctacatcactgtcttaactgtcatgggtgtca 220
           |||||| ||||||||  |||||||||||||||| ||||| || |||||||||||||
Sbjct: 154 gtttgttgccacctttctgttcctctacatcaccgtcttgaccgtcatgggtgtca 209


>gnl|LJGI|DN652353 UniRef100_A3F571 Cluster: Aquaporin; n=1; Cucurbita ficifolia|Rep:
           Aquaporin - Cucurbita ficifolia (figleaf gourd), partial
           (6%)
          Length = 255

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 259 ggtattgcttgggcttttggtggcatgatctttgcccttgtctactgcac 308
           ||||| |||||||| ||||||||||||||||| | |||||| ||||||||
Sbjct: 206 ggtatagcttgggcctttggtggcatgatcttcgtccttgtttactgcac 255