Miyakogusa Predicted Gene

Lj2g3v1984680.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v1984680.1 tr|G8A0I2|G8A0I2_MEDTR F-box protein OS=Medicago
truncatula GN=MTR_103s0066 PE=4 SV=1,48.43,0,seg,NULL; F_box_assoc_1:
F-box protein interaction domain,F-box associated interaction domain;
FBA_1,gene.g42547.t1.1
         (1138 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO010439 similar to UniRef100_A2Q609 Cluster: Cyclin-li...    52   8e-06

>gnl|LJGI|GO010439 similar to UniRef100_A2Q609 Cluster: Cyclin-like F-box; F-box
           protein interaction domain; n=1; Medicago
           truncatula|Rep: Cyclin-like F-box; F-box protein
           interaction domain - Medicago truncatula (Barrel medic),
           partial (18%)
          Length = 736

 Score = 52.0 bits (26), Expect = 8e-06
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 382 ttgtggaacccctctactgaggaattcaagattattcctccaagccctatcgagtctcta 441
           |||||||||||  ||||||| |||||||   ||| |||||| |||||||  |||||||||
Sbjct: 412 ttgtggaacccagctactgaagaattcagagttactcctcccagccctagagagtctcta 471

                 
Query: 442 ccttat 447
           ||||||
Sbjct: 472 ccttat 477